ID: 1115619055

View in Genome Browser
Species Human (GRCh38)
Location 14:35122766-35122788
Sequence GGGTGAGGGCCCCTAGACTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115619044_1115619055 19 Left 1115619044 14:35122724-35122746 CCCCCCACCGGAGGAGTTTTGCG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1115619055 14:35122766-35122788 GGGTGAGGGCCCCTAGACTTCGG 0: 1
1: 0
2: 0
3: 10
4: 111
1115619045_1115619055 18 Left 1115619045 14:35122725-35122747 CCCCCACCGGAGGAGTTTTGCGG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1115619055 14:35122766-35122788 GGGTGAGGGCCCCTAGACTTCGG 0: 1
1: 0
2: 0
3: 10
4: 111
1115619047_1115619055 17 Left 1115619047 14:35122726-35122748 CCCCACCGGAGGAGTTTTGCGGT 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1115619055 14:35122766-35122788 GGGTGAGGGCCCCTAGACTTCGG 0: 1
1: 0
2: 0
3: 10
4: 111
1115619050_1115619055 12 Left 1115619050 14:35122731-35122753 CCGGAGGAGTTTTGCGGTCTGTA 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1115619055 14:35122766-35122788 GGGTGAGGGCCCCTAGACTTCGG 0: 1
1: 0
2: 0
3: 10
4: 111
1115619041_1115619055 28 Left 1115619041 14:35122715-35122737 CCTCCTCGTCCCCCCACCGGAGG 0: 1
1: 0
2: 2
3: 10
4: 193
Right 1115619055 14:35122766-35122788 GGGTGAGGGCCCCTAGACTTCGG 0: 1
1: 0
2: 0
3: 10
4: 111
1115619040_1115619055 29 Left 1115619040 14:35122714-35122736 CCCTCCTCGTCCCCCCACCGGAG 0: 1
1: 0
2: 2
3: 15
4: 250
Right 1115619055 14:35122766-35122788 GGGTGAGGGCCCCTAGACTTCGG 0: 1
1: 0
2: 0
3: 10
4: 111
1115619048_1115619055 16 Left 1115619048 14:35122727-35122749 CCCACCGGAGGAGTTTTGCGGTC 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1115619055 14:35122766-35122788 GGGTGAGGGCCCCTAGACTTCGG 0: 1
1: 0
2: 0
3: 10
4: 111
1115619049_1115619055 15 Left 1115619049 14:35122728-35122750 CCACCGGAGGAGTTTTGCGGTCT 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1115619055 14:35122766-35122788 GGGTGAGGGCCCCTAGACTTCGG 0: 1
1: 0
2: 0
3: 10
4: 111
1115619043_1115619055 25 Left 1115619043 14:35122718-35122740 CCTCGTCCCCCCACCGGAGGAGT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1115619055 14:35122766-35122788 GGGTGAGGGCCCCTAGACTTCGG 0: 1
1: 0
2: 0
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115619055 Original CRISPR GGGTGAGGGCCCCTAGACTT CGG Intronic
900981889 1:6050364-6050386 GGGTGAGGGTCACTGGACTGGGG + Intronic
901325017 1:8360639-8360661 GGGTGAGGGCCCCGAGAGGTGGG + Exonic
901674388 1:10874465-10874487 GGGTGAGGCCACCCAGACCTGGG + Intergenic
902674253 1:17997482-17997504 GGGTAAGGGACCCTAGAGTGGGG + Intergenic
902767876 1:18629357-18629379 GGGGGAGGGCCCCATAACTTGGG + Intergenic
906274567 1:44506469-44506491 GGGTGAGGGCCTCTCCACTCGGG + Intronic
909063498 1:70905483-70905505 GGGTGGGTTCCCATAGACTTGGG - Intronic
910803742 1:91170447-91170469 GGGTGAGGGCCTCTGGATTTCGG + Intergenic
915584188 1:156835006-156835028 GGGTGTGGGAACCCAGACTTGGG + Intronic
915597318 1:156902972-156902994 AGGTGATGGCACCTAGAGTTGGG + Intronic
1063072152 10:2677567-2677589 GGTTGAGGGTCCCTAAACTTGGG - Intergenic
1063381319 10:5587959-5587981 GGGTGAGGACCCCAAGTCTACGG - Intergenic
1063759596 10:9058000-9058022 GGATGAGGGCCCCGTGACCTGGG + Intergenic
1067112174 10:43408591-43408613 GGGTACGGGGCCCTGGACTTCGG + Intronic
1067179631 10:43974753-43974775 GGGTGATGGCCCCAGGCCTTGGG + Intergenic
1068260777 10:54578233-54578255 GTTTGAGGGCCCCTAATCTTGGG + Intronic
1076750175 10:132538332-132538354 GGGTCTGGGCTCCCAGACTTGGG - Intronic
1082188001 11:49208133-49208155 GGGTGAGCACCCCTCGAGTTAGG - Intronic
1083616498 11:64029000-64029022 GGGAGAGGGACCCTGGACTCAGG + Intronic
1084154865 11:67307809-67307831 GGGAAAGGGCCCCTTGACTGAGG + Intronic
1087832015 11:102829709-102829731 GGGGGAGGGACACTAGACTGGGG - Intergenic
1087832021 11:102829728-102829750 GGGGGAGGGACACTAGACTGGGG - Intergenic
1088729870 11:112671165-112671187 TGGTTAGGGCCACTAGACCTGGG + Intergenic
1091075967 11:132617460-132617482 GGGAGAGGGACACTAGACATAGG - Intronic
1091206478 11:133824729-133824751 GGGTGAGGGGCCCGAGAATACGG - Intergenic
1092231784 12:6779830-6779852 AGGTGTGGGGCCCTGGACTTTGG + Intergenic
1092440948 12:8502572-8502594 AGTTGTGGGCCCCTAGACCTTGG - Intergenic
1096258932 12:50078979-50079001 GGGTGAGCGCCCCTGGCCTGGGG + Exonic
1098688719 12:73459387-73459409 AGGTGAGGGCCCCTTGACCTTGG - Intergenic
1099116433 12:78631331-78631353 GGGTGTGCGCCCCCAAACTTGGG - Intergenic
1099360826 12:81698437-81698459 AGATGAGGACCCCTTGACTTTGG + Intronic
1103474558 12:121209352-121209374 GAGTGCGGGCTCCTAAACTTGGG - Intergenic
1104165830 12:126228985-126229007 GGGTGAGGGCTACAAGAGTTTGG + Intergenic
1113435862 13:110290585-110290607 GGGTGAGTGCCCAGAGATTTTGG - Intronic
1113588019 13:111479024-111479046 ATGTGAGGAACCCTAGACTTGGG + Intergenic
1114483096 14:23047440-23047462 AGGTCAGTGCCCCTAGACTGTGG - Exonic
1115619055 14:35122766-35122788 GGGTGAGGGCCCCTAGACTTCGG + Intronic
1121611515 14:95284152-95284174 GGGTGAAAGCCCCAAGCCTTGGG + Intronic
1125686638 15:41567478-41567500 GGGAGAGGGCCCCAAGGCATTGG - Exonic
1125890502 15:43262090-43262112 GAGTGAGGGGCCCTTGAGTTGGG - Intronic
1131890074 15:96963234-96963256 GGGTGAGGGTCTCTAGAGTACGG - Intergenic
1132253300 15:100350464-100350486 GGATGAGGGCCCTTAGTGTTAGG + Intergenic
1133744222 16:8674836-8674858 GGGGGAGGGCCCCGCGTCTTGGG - Intronic
1135251145 16:20901440-20901462 GGGGGAGGGCCCCTCGAAATCGG + Intronic
1139433867 16:66925320-66925342 GGGTGAGGGCGCCGCGACCTGGG - Intronic
1142686244 17:1578389-1578411 GGGTGAGGGCCCCCAGGAATTGG - Intronic
1145863351 17:28225606-28225628 GGGTGGTGGGCCCCAGACTTAGG + Intergenic
1146652883 17:34617280-34617302 TGTTGAGGGGCCCTAGAATTTGG - Intronic
1147339618 17:39745791-39745813 GGGTGACGGCCCCGAGTCCTGGG + Intronic
1147966873 17:44198864-44198886 GGGTGGGGGTTCCTGGACTTTGG - Intronic
1148212844 17:45818601-45818623 GGGTGATGGCCTCTCGACATGGG + Intronic
1149566041 17:57641335-57641357 AGGTGAGGGCCACTGGACTGGGG + Intronic
1149640314 17:58198693-58198715 GGGCAAGGGCACCTTGACTTTGG - Intronic
1149929900 17:60740958-60740980 GTGTGAGGGCCCCTAGGTCTGGG + Intronic
1152410023 17:80118413-80118435 GGGTGAGGGGACCTGGGCTTGGG + Intergenic
1162094343 19:8301871-8301893 GGGTGGGGGTCCCCAGACCTGGG + Intronic
1164851176 19:31485421-31485443 GGGTGAAAGCCCCAAGCCTTGGG - Intergenic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
1167753495 19:51395058-51395080 GGGTGAGGGCCTCTAAATCTGGG - Intergenic
924993639 2:337922-337944 GGGTGAAAGCCCCAAGCCTTGGG + Intergenic
925750971 2:7090329-7090351 GGCTCACGGCCCCTGGACTTTGG + Intergenic
929151366 2:38751659-38751681 GGCTGAGGGTCCCTAGCCTGGGG - Intronic
929487454 2:42367615-42367637 GGGCCAGTGCCCCTTGACTTGGG - Intronic
932615511 2:73228774-73228796 GGGTGAGGGCTCCTTGCCTCTGG - Exonic
933437203 2:82263017-82263039 GGGTGAGTGCCCCTGGGCTCTGG + Intergenic
937438410 2:121897570-121897592 TGGTGAGGACCCCAAGGCTTGGG - Intergenic
944068697 2:195646592-195646614 GGGTGAGGACCCCTGAACTAAGG - Intronic
947887918 2:233590537-233590559 GGGTGAGGCTCTCAAGACTTGGG - Intergenic
948097472 2:235347671-235347693 GAGTGAGGGCATCTAGGCTTTGG - Intergenic
1169256317 20:4102580-4102602 GGGTGAGGGCCCCTACCCATGGG + Intergenic
1170570212 20:17628354-17628376 GGGTGTGGGCTCGTAGGCTTCGG - Intronic
1171132383 20:22665720-22665742 GGGTTAGGTCCCCAAGACCTTGG + Intergenic
1171171762 20:23021761-23021783 GGGTGAGGCTGCCTGGACTTAGG - Intergenic
1171249314 20:23636516-23636538 GGGTGAAGGCCGCTAGTCCTAGG + Intronic
1177476794 21:21633926-21633948 GGGTGCAAGCCCCAAGACTTTGG - Intergenic
1184388995 22:44192346-44192368 GGGTGGGGGCCCCTGGGTTTGGG + Intronic
950750052 3:15121275-15121297 GGGTGAGGGAGCCCAGACTAGGG + Intergenic
952041728 3:29269077-29269099 GTGTGAGGCCCCTGAGACTTTGG - Intergenic
953041126 3:39255759-39255781 CGGGGAGGGCCCCTTAACTTTGG + Intergenic
953772915 3:45792556-45792578 GGGTGAGGGCCCCCAGTAGTTGG - Intronic
953932684 3:47013542-47013564 GGGTGGGGGTCCCTAGGCTGTGG + Intergenic
957356489 3:79094753-79094775 GGCTGAGGGATTCTAGACTTGGG + Intronic
964247126 3:154666733-154666755 AGGTGAGTGCCCCTGGGCTTCGG + Intergenic
965746514 3:171932131-171932153 GAGTGAGGGCCCATAGAATTTGG - Intronic
965898719 3:173612614-173612636 AGGTGCTGGCCCCTAGACTTAGG + Intronic
968682819 4:1933151-1933173 TGGTGAGGGCCCCCACGCTTTGG + Intronic
969194694 4:5551305-5551327 AGGTGAGTTCCCCTAGTCTTGGG - Intronic
971032671 4:22658058-22658080 GGGTGAGGACCCCTAACCCTGGG + Intergenic
972642242 4:40935580-40935602 GGCTGAGGGCCCCAAAAGTTGGG + Intronic
974203387 4:58669291-58669313 GGGTGTGGGCCCCTGCAGTTGGG - Intergenic
981429809 4:144645924-144645946 GGGGGAGGGCCGCGAGCCTTCGG - Intergenic
985695949 5:1340201-1340223 GGGTGAGAGCCCCCTGACCTTGG + Intronic
986633553 5:9798218-9798240 GGGAGAGGGCTCCTAGGGTTGGG + Intergenic
989719169 5:44504272-44504294 GGGTGAGTACCCCTGGGCTTTGG - Intergenic
993439958 5:87944511-87944533 GGTTTAGGACCTCTAGACTTAGG - Intergenic
996669498 5:126100696-126100718 GGGCGAGTGCCCCTGGACTCCGG + Intergenic
997549319 5:134738365-134738387 GGGTGAGGGCCAGAAGAGTTGGG + Intergenic
1006379110 6:33687567-33687589 GGGTGCTGGCCCCGAGACTGGGG + Intronic
1006632319 6:35438145-35438167 GGGTGAGGGCTGCTGGATTTGGG - Intergenic
1010185171 6:73135530-73135552 GGGCAAGGGCCCCTAGAGTAGGG - Intronic
1011653280 6:89526589-89526611 GGGTGAGGGCTCCTAAACTATGG + Intronic
1017988151 6:159462731-159462753 GGGTTGGGGCCACAAGACTTAGG + Intergenic
1021233467 7:18114036-18114058 GGCTGAGGACCTCAAGACTTTGG + Intronic
1023871781 7:44267138-44267160 GGGTGAGGTCCCCTGGAGGTCGG - Intronic
1032436523 7:131905491-131905513 GGGTGAGAGACCCAAGAGTTTGG - Intergenic
1034066750 7:148144340-148144362 AGCTGAGGGACCCTGGACTTAGG - Intronic
1037819502 8:22128918-22128940 GGGCGAGGGCCCCCAGAATGGGG - Exonic
1038489081 8:27956833-27956855 GGGAGAGGGCCCCAAGCCTTGGG + Intronic
1039640739 8:39218612-39218634 GGGTGAGGGTCCTTAGCCTATGG - Intronic
1043370327 8:79583840-79583862 GGGTGCAGGCCCCAAGCCTTGGG + Intergenic
1045564029 8:103295470-103295492 GGGGGAGGGGGCCTAGTCTTTGG + Intergenic
1049197267 8:141322730-141322752 GGCTGGGGGCCCCTAGCCGTGGG + Intergenic
1049308999 8:141923531-141923553 GGGTGAGCTCCCCTAGAGCTAGG + Intergenic
1049407202 8:142457074-142457096 GGGTGATGAGCCCTAGACTACGG + Intronic
1056877153 9:90344787-90344809 GGGTCAGGGAGACTAGACTTAGG - Intergenic
1058662872 9:107282849-107282871 GGGTGCTGGCCCCCAGACTGTGG + Intergenic
1061480713 9:130896543-130896565 GGGTGAGGGCCCCTGGAATGGGG - Intergenic
1061979672 9:134094394-134094416 GGGGGAAGGCCCCTTGACATTGG + Intergenic
1062397184 9:136357230-136357252 GGTTCAGGGTCCGTAGACTTGGG + Intronic
1190185987 X:48234614-48234636 GGCTGGTGGCCCCTAGGCTTGGG + Intronic
1193815808 X:86103066-86103088 TGGTGAGGTCCCCCAGGCTTAGG - Intergenic
1200487560 Y:3787161-3787183 TGGTGAGGACCCGTACACTTAGG + Intergenic