ID: 1115623772

View in Genome Browser
Species Human (GRCh38)
Location 14:35168760-35168782
Sequence TCACTAATAGTCACATACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115623772 Original CRISPR TCACTAATAGTCACATACGG GGG (reversed) Intronic
906541183 1:46587292-46587314 CCACTAATAGACACATGTGGTGG - Intronic
922609671 1:226916209-226916231 TCACTGATACTCATATACGCTGG - Intronic
1065416449 10:25492469-25492491 TCACTAATTGGAACATACAGTGG - Intronic
1086836361 11:91628589-91628611 CCACTAACAGTCTCATAAGGAGG - Intergenic
1115623772 14:35168760-35168782 TCACTAATAGTCACATACGGGGG - Intronic
1119315257 14:73688953-73688975 TCATGAATAGTCACAAACTGAGG + Intronic
1123192462 14:106584449-106584471 TCTTTAATGGTCACATAAGGTGG + Intergenic
1127809988 15:62557312-62557334 TCACTAATTGTCAGATCCAGAGG + Intronic
1144815464 17:18031334-18031356 TCACTAATACTTACAGACAGAGG + Intronic
1148928352 17:51107449-51107471 GCAATAATAGTCAGACACGGTGG + Intronic
1149682425 17:58515353-58515375 TCACCAAGAGTCACAGAGGGAGG + Intronic
930842848 2:55866710-55866732 CCACTAACAGTCTCATAAGGAGG - Exonic
1179557904 21:42192357-42192379 TCACAAATTGTCACACATGGTGG - Intergenic
1181297153 22:21848760-21848782 TCACTGATAGGCAGATACAGTGG - Intronic
1182823671 22:33243084-33243106 TTACAAATAGTCACATTCTGAGG + Intronic
951946953 3:28149129-28149151 TTACTAATAGTCACCTACCAAGG - Intergenic
972786297 4:42329656-42329678 TCACTTATAGTTACACAAGGAGG + Intergenic
982775979 4:159441759-159441781 TCACATATAGTCACATTCTGAGG + Intergenic
983678850 4:170329148-170329170 TCACTAAGAGTCACAGTCAGTGG + Intergenic
993894668 5:93519432-93519454 ACACTAATATTCACATACGTGGG + Intergenic
994856787 5:105131714-105131736 TCACTGATTGACACATACTGTGG + Intergenic
995179985 5:109222081-109222103 TCAAAAATAGTCACATTCTGTGG - Intergenic
1000714104 5:164619859-164619881 CCACTAATAGTCACAAAAAGAGG + Intergenic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1003259061 6:4500158-4500180 TTACTAACAGTCACTTACCGAGG - Intergenic
1009964183 6:70561046-70561068 TCACTAATTGTGACAGACAGAGG + Exonic
1035378657 7:158424472-158424494 TCACTAATATTCATCTCCGGTGG - Intronic
1041754372 8:61297519-61297541 TCACTAAAAGACAAAGACGGAGG + Intronic
1041779460 8:61561409-61561431 TCACTAATAGCTACACAGGGTGG - Intronic
1043311461 8:78864900-78864922 TCACTGATTGACACATACTGAGG + Intergenic
1044260689 8:90116585-90116607 TAACTAAAAGTCATATAGGGTGG + Intergenic
1045264348 8:100606484-100606506 TCTCTAAAAGTCACTTAAGGAGG + Intronic
1055466458 9:76571364-76571386 TAACTTAAAGTCACATACAGTGG + Intergenic
1061649679 9:132037352-132037374 ACAGTAATAGTCGCATATGGTGG + Intronic
1188021557 X:25164074-25164096 TCACTCATAGTCATATACATGGG - Intergenic
1196368987 X:114954231-114954253 TCACAAACAATCACATAAGGAGG + Intergenic
1198069166 X:133130793-133130815 TCTCTAATAGACACAAACAGAGG - Intergenic