ID: 1115629194

View in Genome Browser
Species Human (GRCh38)
Location 14:35226871-35226893
Sequence GTGTGTTAGTGCATGTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 445}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115629194_1115629198 11 Left 1115629194 14:35226871-35226893 CCTAGAGACATGCACTAACACAC 0: 1
1: 0
2: 4
3: 34
4: 445
Right 1115629198 14:35226905-35226927 TTGTATATTTTGAAGAGACAGGG 0: 1
1: 135
2: 4709
3: 79950
4: 185392
1115629194_1115629197 10 Left 1115629194 14:35226871-35226893 CCTAGAGACATGCACTAACACAC 0: 1
1: 0
2: 4
3: 34
4: 445
Right 1115629197 14:35226904-35226926 TTTGTATATTTTGAAGAGACAGG 0: 2
1: 207
2: 8131
3: 193266
4: 230715

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115629194 Original CRISPR GTGTGTTAGTGCATGTCTCT AGG (reversed) Intronic
900150525 1:1177140-1177162 GTGTGTCTGTGCATGTTTATAGG + Intronic
900150526 1:1177162-1177184 GTGTGTGTGTGCATGTCTGTAGG + Intronic
900293773 1:1938270-1938292 GAGTGTGAGTGCATGTATGTGGG - Intronic
900293776 1:1938304-1938326 GTGTGTGAGTGCATGTATGTGGG - Intronic
900580936 1:3408608-3408630 GTGTGTGAGTGCATGAGTGTGGG + Intronic
901804612 1:11730303-11730325 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
901804619 1:11730365-11730387 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
903223813 1:21883928-21883950 GTGTCTTTGGGCAAGTCTCTTGG - Intronic
904030174 1:27528590-27528612 GTGTGCGCGTCCATGTCTCTGGG + Intergenic
904197916 1:28799837-28799859 GTGTGTTAGTTCAGGTCTGAAGG + Intergenic
905347173 1:37319080-37319102 GTGTGTGTGTGCCTGTCTGTTGG + Intergenic
906689490 1:47783211-47783233 GTCTCTTACTGCCTGTCTCTGGG - Intronic
906758349 1:48344632-48344654 GTGTGTCACTGCATGTCTCTTGG - Intronic
906861432 1:49364614-49364636 GTGTGGTGGTGCACGTCTGTAGG - Intronic
907567554 1:55450026-55450048 GGGGGTGAGTGCTTGTCTCTTGG + Intergenic
908433492 1:64081803-64081825 GTGTGTTTGTGTATGTGTGTGGG - Intronic
910230421 1:84981137-84981159 GTTTGTTATTGCCTGTCTTTTGG - Intronic
913536308 1:119775713-119775735 GTGTGTGAGTTCATGTTCCTTGG - Intergenic
913936940 1:125064388-125064410 GTGTGTGTCTGCATGTGTCTGGG - Intergenic
913973757 1:143437284-143437306 GTGTGGTGGTGCATGCCTGTAGG + Intergenic
914068142 1:144262891-144262913 GTGTGGTGGTGCATGCCTGTAGG + Intergenic
914111013 1:144703463-144703485 GTGTGGTGGTGCATGCCTGTAGG - Intergenic
914359353 1:146918923-146918945 GTTTGTTATTGCCTGTCTTTTGG + Intergenic
914494396 1:148180952-148180974 GTTTGTTATTGCCTGTCTTTTGG - Intergenic
915152675 1:153847103-153847125 GTGTGGTGGTGCACGTCTGTAGG - Intronic
915293490 1:154902556-154902578 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
915328413 1:155093244-155093266 TTGTGTTTGTGTATGTGTCTGGG - Intergenic
915625648 1:157112599-157112621 GTGTGTGAGCCCATGTTTCTGGG + Intergenic
916559967 1:165926200-165926222 GTGTGTATGTGCATGTGTCAGGG + Intergenic
916768564 1:167885447-167885469 GTTTGTTATTGCCTGTCTTTTGG + Intronic
917000062 1:170347860-170347882 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
917791755 1:178503637-178503659 GTGTGTATGTGCGTGTTTCTTGG - Intergenic
918747525 1:188224070-188224092 TTGTGTTATTGCCTGTCTTTTGG + Intergenic
920282497 1:204854497-204854519 GTGGGTGTGTGCATGACTCTGGG + Intronic
920596157 1:207272375-207272397 GTTTGTTATTGCCTGTCTCTTGG + Intergenic
921051004 1:211511788-211511810 GTGTGGTGGTGCGTGTCTGTAGG - Intergenic
921445377 1:215240415-215240437 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
922399003 1:225232376-225232398 ATGTGCTTGTACATGTCTCTTGG + Intronic
923071247 1:230566671-230566693 GCATGTTATTGCCTGTCTCTTGG - Intergenic
924395144 1:243610709-243610731 GGGTATTAGTGCTTGTCTTTGGG - Intronic
1065128513 10:22597274-22597296 CTGTGTGAGTGCCTGACTCTGGG - Intronic
1065241537 10:23709790-23709812 GTGAGTTACTTCATCTCTCTAGG - Intronic
1065317402 10:24476791-24476813 GTGTCTATGTGCAGGTCTCTAGG - Intronic
1065774023 10:29102773-29102795 AGGTGTTACTGCATTTCTCTGGG - Intergenic
1066206098 10:33190796-33190818 GTGTGTGTGTGCATGTGTGTTGG + Intronic
1067442556 10:46317706-46317728 GTGTGTGTGTGCATGTGTTTTGG - Intronic
1068533848 10:58218155-58218177 GTGTGTCAGTGCTTCTCCCTTGG - Intronic
1068957318 10:62829880-62829902 GAATGTGAGTCCATGTCTCTTGG + Intronic
1069289707 10:66763039-66763061 GAGTGTATGTGCATGTCTGTGGG + Intronic
1070547238 10:77462562-77462584 GTGTGTAAGTGCATGTGTGAGGG - Intronic
1070911950 10:80126758-80126780 GTGTGAATGTGGATGTCTCTCGG - Intergenic
1071127486 10:82352184-82352206 GTGTGTTTGTGCATGTATGTGGG - Intronic
1071505396 10:86228722-86228744 GTGTGTGTGTGGGTGTCTCTTGG - Intronic
1071887989 10:89971447-89971469 GTCTGTCAGTGCATTTTTCTGGG + Intergenic
1072800004 10:98386136-98386158 GTGTGGTGGTGCATGCCTGTAGG + Intronic
1073964465 10:108972773-108972795 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
1074210608 10:111330515-111330537 ATGTGTTTGTGCATTTCTATAGG + Intergenic
1074236733 10:111592255-111592277 GTGTGTGTGTGCATGTATGTAGG + Intergenic
1076377133 10:129998486-129998508 ATTTGTTATTGCCTGTCTCTTGG - Intergenic
1076535843 10:131176455-131176477 GTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535852 10:131176679-131176701 GTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535863 10:131176911-131176933 GTGTCTGTGTGCATGTATCTTGG - Intronic
1077251472 11:1562762-1562784 GTGCGTCTGTGCATGGCTCTGGG - Intronic
1077682741 11:4259543-4259565 ATTTGTTATTGCCTGTCTCTTGG + Intergenic
1077687298 11:4307210-4307232 ATTTGTTATTGCCTGTCTCTTGG - Intergenic
1077692460 11:4358387-4358409 ATTTGTTATTGCCTGTCTCTTGG - Intergenic
1077922910 11:6655256-6655278 GTGTGTCAGTGCGTGTCACTGGG - Intronic
1078065930 11:8079690-8079712 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1078863542 11:15275721-15275743 TTGTGTCAGTGCATTTTTCTAGG - Intergenic
1079114169 11:17630075-17630097 ATGTGTTAGTGCATGTGTAGAGG - Intronic
1079784207 11:24650389-24650411 GTGTGTTGTTGCATGTATGTTGG - Intronic
1080404143 11:31964132-31964154 GTGTGTTGGTGCAACCCTCTTGG - Intronic
1081422621 11:42889218-42889240 ATGTGTTATTGCCTGTCTTTTGG - Intergenic
1081831542 11:46120106-46120128 GTGTGTTGGTGCATTTGTCTTGG - Intronic
1082825759 11:57577125-57577147 GTTTGATAATGCATGTCTTTGGG + Intergenic
1083557438 11:63642071-63642093 GTGTGTATGTGTATGTCTCTAGG - Intronic
1084903796 11:72330369-72330391 GTGGGTGAGTGCATGTGGCTGGG + Intronic
1086585767 11:88449326-88449348 GTTTGTTATTGCCTGTCTTTTGG - Intergenic
1086737468 11:90323686-90323708 GTTTGTTATTGCCTGTCTTTTGG + Intergenic
1087173484 11:95074569-95074591 GTGGGTTAGGTAATGTCTCTGGG + Intergenic
1088463153 11:110104195-110104217 GTGTGGTGGTGCATGCCTGTCGG - Intronic
1089259753 11:117215979-117216001 GTGTGGTGGTGCATGCCTCCTGG - Intronic
1091196978 11:133739375-133739397 GTGTGTTTGTGTATGTGTGTGGG + Intergenic
1091244199 11:134077987-134078009 GAGTGACAGTGCCTGTCTCTGGG + Intronic
1091639956 12:2228940-2228962 GTGTGTGTGTGCATATCTCCTGG + Intronic
1091684080 12:2549340-2549362 GAATCTTAGTGCATGGCTCTGGG + Intronic
1091925739 12:4346880-4346902 ATGTGTTATTGCCTGTCTTTTGG - Intronic
1091963358 12:4718135-4718157 GTGTGTCAGTGAAGGTCTCTTGG - Intronic
1093602136 12:21040413-21040435 GTTTGTTATTGCTTGTCTTTGGG + Intronic
1094773638 12:33695735-33695757 ATTTGTTATTGCCTGTCTCTTGG + Intergenic
1095731925 12:45515286-45515308 GTGTGTGTGTGCATGTCTATGGG - Intergenic
1098527868 12:71507429-71507451 CTGTGTCTGTGCATGTGTCTGGG + Intronic
1098966860 12:76799565-76799587 GCGTGTTGGAGCATGTTTCTGGG + Intronic
1098974169 12:76885057-76885079 GTGTGTCTGTGTATTTCTCTGGG + Intergenic
1099987914 12:89689535-89689557 GGTTGTTAGTGCATTTGTCTGGG - Intronic
1101360283 12:104020056-104020078 GTGTGGTGGTGCATGCCTGTAGG - Intronic
1102985742 12:117277143-117277165 GTTTGTTATTGCCTGTCTTTCGG + Intronic
1103356299 12:120323658-120323680 GTGTGTGTGTGTATTTCTCTGGG + Intronic
1104698301 12:130881218-130881240 GTGTGTGTGTGTGTGTCTCTGGG + Intergenic
1104698303 12:130881250-130881272 GTGTGTGTGTGTGTGTCTCTGGG + Intergenic
1107308055 13:39044325-39044347 GTGTGTTAGTGGGTATGTCTGGG + Intronic
1107333281 13:39325182-39325204 GTGTGTACCTGCATGTCTGTGGG - Intergenic
1107399913 13:40059765-40059787 GTGTGCTGCTGCGTGTCTCTTGG - Intergenic
1108004361 13:45932334-45932356 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1108959893 13:56213601-56213623 GTGTGTTTGTGTATGTGTGTGGG - Intergenic
1109100284 13:58175062-58175084 ATTTGTCATTGCATGTCTCTTGG + Intergenic
1110188115 13:72698942-72698964 GTGTGGTGGTGCATGCCTGTAGG - Intergenic
1110370360 13:74733094-74733116 GTGTGTATGTGCATGTGTTTAGG - Intergenic
1110500793 13:76225340-76225362 GTGTGTGTGTGCATGTGTTTAGG - Intergenic
1110918597 13:81056188-81056210 GTGTGTTACTGCATATGTTTGGG + Intergenic
1111117185 13:83794783-83794805 GTGTGTTCAGGCATGTCTGTAGG - Intergenic
1111553878 13:89854129-89854151 GTGTGTTTGTGAAGGTCTATAGG + Intergenic
1111644280 13:91010555-91010577 GTGTGTAAGTGCACGTGTATAGG - Intergenic
1113964030 13:114142355-114142377 GTGTGTCAGTGTATGTGTATGGG - Intergenic
1114480062 14:23027521-23027543 GTGTGGTGGTGCATGTCTGTGGG + Intronic
1114497225 14:23141144-23141166 GTGTGGTGGTGCATGCCTATAGG + Intronic
1115535401 14:34368200-34368222 GAGTGGTGGTGCATGTCTATAGG - Intronic
1115629194 14:35226871-35226893 GTGTGTTAGTGCATGTCTCTAGG - Intronic
1117291365 14:54336824-54336846 GTGTGGTGGTGCATGCCTGTTGG + Intergenic
1118065759 14:62188617-62188639 CTGTGTTTGTGGATCTCTCTGGG + Intergenic
1118188568 14:63559708-63559730 GTGTGTTTGTGTATGTGTATGGG + Intergenic
1121020472 14:90577323-90577345 GTGTGTTAGTGCAGCTGCCTCGG - Intronic
1122088222 14:99321424-99321446 GGGTGTGAGTGCATGTGTGTGGG - Intergenic
1122088232 14:99321486-99321508 GTGTGTGAGCGCATGTGTATAGG - Intergenic
1123780213 15:23618905-23618927 GTGTGTTGGTGTATGTGACTGGG - Intronic
1123919947 15:25063109-25063131 GTCTTTGAGGGCATGTCTCTGGG + Intergenic
1123920827 15:25068568-25068590 GTCTTTGAGGGCATGTCTCTGGG + Intergenic
1124108776 15:26767168-26767190 GTGTGTCTGTGCTTGGCTCTAGG - Intronic
1124237789 15:28004631-28004653 GTGTGTCAGACCATGTGTCTGGG - Intronic
1124250876 15:28105924-28105946 GGGTGTGTGTGCATGTGTCTGGG + Intergenic
1124250916 15:28106230-28106252 GTGTGTGTGTGCATGTGTCGGGG + Intergenic
1124793873 15:32756740-32756762 GTTTGTTATTGCCTGTCTTTTGG + Intergenic
1127160794 15:56182797-56182819 GTGTCTTTGTATATGTCTCTTGG + Intronic
1127406362 15:58651906-58651928 GTTTGTTATTGCCTGTCTTTTGG + Intronic
1127719320 15:61684283-61684305 GAGAGTTACTGCATGTCTCTAGG - Intergenic
1127745928 15:61972482-61972504 GTGTGTATGTGCATGTGTGTTGG + Intronic
1127994055 15:64142200-64142222 GTGTGGTGGTGCATGCCTGTAGG + Intronic
1128180805 15:65602073-65602095 GTGTGGTAGTGCACTTCTGTAGG + Intronic
1128194432 15:65739134-65739156 GTATGTTTGTGCATTTCTATAGG - Intronic
1128276953 15:66361865-66361887 GTGTGGTGGTGCATGCCTGTAGG + Intronic
1130138440 15:81201270-81201292 GTGTGTGCGTGCATGTGTGTGGG - Intronic
1130520642 15:84658351-84658373 GTGTGGGTGTGCAGGTCTCTGGG - Exonic
1131493237 15:92881127-92881149 CTGTGTAAGGGAATGTCTCTTGG + Intergenic
1131663423 15:94543388-94543410 GTGGATTAGTTCTTGTCTCTGGG - Intergenic
1132052888 15:98625005-98625027 GTGTGTGTGTGCATGATTCTAGG + Intergenic
1132699740 16:1217298-1217320 GTCTGTGTGTGCACGTCTCTAGG - Intronic
1132998538 16:2837105-2837127 GTGTATTTGTGTGTGTCTCTGGG - Intronic
1133896218 16:9931836-9931858 GTGTGTTTGTGAATGTCTACAGG - Intronic
1134059843 16:11192496-11192518 GTGTGTGTGTGCATGTCTCTGGG - Intergenic
1134331661 16:13256914-13256936 GTGTGTATGTGTATGTTTCTGGG - Intergenic
1134529510 16:14972199-14972221 GTGAGTGAGTGCATTTTTCTGGG - Intergenic
1134782249 16:16908895-16908917 GTGTGTGTGTGCGTGTGTCTGGG + Intergenic
1135856079 16:26011729-26011751 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1136228005 16:28871993-28872015 GTGTGAGTGTGCATGTCTCCAGG + Intronic
1138515474 16:57533493-57533515 GTGTGTGAGTGCGGGTCCCTGGG - Intronic
1138515485 16:57533549-57533571 GTGTGTGAGTGCAGGTCCCTGGG - Intronic
1138515495 16:57533603-57533625 GTGTGTGAGTGCGGGTCCCTGGG - Intronic
1138515506 16:57533657-57533679 GTGTGTGAGTGCAGGTCCCTCGG - Intronic
1138709441 16:58953204-58953226 ATTTGTTATTGCCTGTCTCTTGG + Intergenic
1138764711 16:59588067-59588089 ATGTGTTATTGCCTGTCTTTTGG - Intergenic
1140142168 16:72268683-72268705 ATGTGTTATTGCCTGTCTTTTGG + Intergenic
1140668726 16:77252973-77252995 GTGTGTTTTTGTATGTCTGTTGG + Intronic
1140946143 16:79770196-79770218 GTGTGTTTGTGCACGTGTATGGG + Intergenic
1141243302 16:82283295-82283317 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1142378719 16:89720416-89720438 GTGCGTTCGTGCATTTTTCTGGG - Intronic
1142639130 17:1275418-1275440 GTGTGTGAGTGAATGTGTGTGGG + Intergenic
1142927598 17:3254525-3254547 ATTTGTTACTGCCTGTCTCTTGG - Intergenic
1143269172 17:5663020-5663042 GTGTGTGAGTGCATGTCACATGG - Intergenic
1144461906 17:15465205-15465227 GTGTGTTGGTGTGTGTCTGTTGG - Intronic
1144566804 17:16366339-16366361 GTGTGGTGGTGCATGCCTGTTGG + Intergenic
1145302226 17:21648717-21648739 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1145348087 17:22054599-22054621 GTGTGGGAGTGCATGTTTCAGGG - Intergenic
1145415493 17:22710787-22710809 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1145990829 17:29078545-29078567 GTGTGTTAGTTCATGCATCTGGG + Exonic
1147585503 17:41651907-41651929 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
1148507031 17:48135614-48135636 GTGTGGTGGTGCACGTCTGTAGG - Intronic
1149527844 17:57370756-57370778 GTGTTGTAGCGCAAGTCTCTGGG - Intronic
1149603969 17:57911918-57911940 GTCTGTTTGTGAATGTCACTGGG - Intronic
1149862524 17:60130936-60130958 ATGTGTTACTGCCTGTCTTTTGG + Intergenic
1150047365 17:61926932-61926954 GCGTGTTACTTCATCTCTCTGGG - Intronic
1150071061 17:62150260-62150282 TTGTGTTCGTGCATTTTTCTGGG + Intergenic
1151497146 17:74465252-74465274 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497156 17:74465638-74465660 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497161 17:74465754-74465776 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497163 17:74465804-74465826 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497165 17:74465858-74465880 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497167 17:74465906-74465928 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1153180982 18:2432723-2432745 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
1153608576 18:6858667-6858689 GTGTGGTGGTGCATGCCTGTTGG - Intronic
1154351866 18:13590053-13590075 GTGTGTGACTGCATGTGTGTGGG + Intronic
1154359494 18:13647485-13647507 GTGTGTTTGTGTCTGTCTGTGGG + Exonic
1155155426 18:23153232-23153254 GTGTGGTAGTGCATGCCCGTAGG - Intronic
1155265720 18:24091301-24091323 GTGTGGTAGTGCACATCTGTAGG + Intronic
1155867669 18:30985922-30985944 GTGTGCAAGTGCATGTGTGTGGG + Intergenic
1156336014 18:36172125-36172147 GTGTGATGGTGCATGACTGTGGG + Intronic
1156596407 18:38552746-38552768 GTGTGTGTGTGTATGTCTCAGGG + Intergenic
1156710893 18:39944199-39944221 GTTTGATTGTGCATGTCTATTGG - Intergenic
1157488688 18:48107453-48107475 CTGTGTTAGTGCCTGTCCCCTGG - Intronic
1157872895 18:51246733-51246755 GTGTGCTAGTTCAGATCTCTTGG - Intergenic
1158298847 18:56029896-56029918 GTATGGTAGTGAATGTCTGTAGG + Intergenic
1158636285 18:59161393-59161415 GAGTGTTTGTGCATGTCTGCAGG - Intergenic
1159027533 18:63198990-63199012 GTGTGTCTGTGTATGTCTGTGGG - Intronic
1159783125 18:72682281-72682303 GTGTGTGTGTGAATGTCTATAGG - Intergenic
1160022867 18:75193973-75193995 GTGTGTGTGTGTGTGTCTCTTGG + Intergenic
1160321823 18:77903464-77903486 GTGTGTAACTGCATGGCACTTGG - Intergenic
1160625299 18:80200451-80200473 GGGTGGTAGTGCCTGTCTCTGGG - Intronic
1160686038 19:437020-437042 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1161659516 19:5537420-5537442 GTGTGGTGGTGCATGCCTGTGGG - Intergenic
1161816007 19:6500600-6500622 GTGTGGTGGTGCATGCCTGTAGG + Intronic
1162150648 19:8643086-8643108 GTGTGGTGGTGCATGCCTATGGG - Intergenic
1163181925 19:15610102-15610124 ATGTGTTGGTGCATCTTTCTGGG - Intergenic
1164227774 19:23261011-23261033 GTGTGTTGCAACATGTCTCTGGG - Intergenic
1164408749 19:27978810-27978832 GTTTGTTATTGCGTGTCTTTTGG - Intergenic
1165260487 19:34612175-34612197 GTGTGGTGGTGCATGCCTGTAGG - Intronic
1167095737 19:47374087-47374109 GTGTGTTACTGCTTGTCTCTGGG + Intronic
1168602120 19:57726568-57726590 GTATGTTATTTCATATCTCTGGG - Intronic
925144864 2:1574478-1574500 GTATGTTAGAGCAGGTCTCATGG + Intergenic
925538283 2:4939500-4939522 CTGTTTTAGGGCATGTGTCTGGG - Intergenic
926065345 2:9834915-9834937 GTTTGTTATTGCCTGTCTTTTGG - Intergenic
926766108 2:16324233-16324255 ATGCCTTAGTGCATGTCTTTGGG + Intergenic
928015602 2:27654056-27654078 CTGTGGTTGTGCATGTCTTTGGG - Intronic
928171299 2:29005154-29005176 GTGTGTGAGTGCATGTGTAAGGG + Intronic
928171301 2:29005189-29005211 GTGTGTGTGTGCATGTGTGTGGG + Intronic
928550590 2:32366841-32366863 GTGTGGTGGTGCATGCCTGTAGG + Intronic
928749057 2:34449965-34449987 GTTTGTTATTGCACGTCTTTTGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929592281 2:43155105-43155127 GTGTGTCAGTGAGTGTCTGTGGG - Intergenic
929714635 2:44297736-44297758 GTGTGGTGGTACATGTCTGTAGG - Intronic
930004034 2:46881927-46881949 GTGTGCTGGTGCATGTGTTTGGG + Intergenic
930033174 2:47070403-47070425 GTGTGTGTGTGGGTGTCTCTGGG + Intronic
933990929 2:87633331-87633353 GAGTGTTGGTGCATTTCCCTCGG - Intergenic
934178451 2:89598250-89598272 GTGTGGTGGTGCATGCCTGTAGG + Intergenic
934288745 2:91672542-91672564 GTGTGGTGGTGCATGCCTGTAGG + Intergenic
935533047 2:104259147-104259169 ATGTGTTATTGCCTGTCTTTGGG - Intergenic
935548657 2:104428223-104428245 GTGTGTGTGTGCATTCCTCTGGG + Intergenic
936102597 2:109596168-109596190 GTGTGGTGGTGCATGCCTGTAGG - Intronic
936937397 2:117851531-117851553 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
937171128 2:119870052-119870074 GTGTGTTAGGGTATGTTTGTTGG + Intronic
937581328 2:123492414-123492436 GTGTGTGTGTGCATGTATGTGGG + Intergenic
938192818 2:129299228-129299250 GTGTGTGTGTGCATATCTTTTGG - Intergenic
938813964 2:134880790-134880812 ATGTTTTAGTGCCTGACTCTTGG + Intronic
939527091 2:143309035-143309057 GTGTGTTAGTGCATTGCTAAAGG + Intronic
940240219 2:151554418-151554440 GTGTGGTGGTGCATGCCTGTAGG + Intronic
940900740 2:159124217-159124239 GTGTGGTGGTGCCTGTCTGTAGG + Intronic
942217754 2:173738772-173738794 TTGTGTTTGTGCAGCTCTCTGGG + Intergenic
943099356 2:183469829-183469851 GTTTGTTATTGCCTGTCTTTTGG + Intergenic
943216082 2:185037144-185037166 GTGTGTGTGTGCATTTCTTTAGG + Intergenic
945697920 2:213132079-213132101 GAAAGTTAGTGCTTGTCTCTTGG - Intronic
947339696 2:229124983-229125005 GTGTGTGAGTGTGTGTCTGTTGG + Intronic
948198264 2:236111255-236111277 GCGTGGTAGTGCATGCCTATAGG + Intronic
948212989 2:236208649-236208671 GAGTCTTATTGCCTGTCTCTGGG + Intronic
948354225 2:237364899-237364921 GTGTGTGGGTGCATGTCTGTGGG + Intronic
948640280 2:239371578-239371600 GAGTGTTTGTGAATGTCTGTGGG - Intronic
948692187 2:239713137-239713159 GTGTGTGTGTGAATGTGTCTGGG + Intergenic
1169433781 20:5565368-5565390 ATGTGGTAGTGCATGTCTATGGG - Intronic
1169825652 20:9765856-9765878 GCATTCTAGTGCATGTCTCTTGG - Intronic
1169995119 20:11547489-11547511 GTGTGTTAGTGCCTTGATCTTGG - Intergenic
1170260600 20:14402541-14402563 GTGTGTTTGTGTATGTCTGTGGG + Intronic
1170751850 20:19155542-19155564 ATGTCTTAGAGCATATCTCTGGG - Intergenic
1171518810 20:25760145-25760167 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1172090895 20:32431724-32431746 GTGTGGTGTTGCATGTCTCCTGG + Intronic
1172218061 20:33250529-33250551 GTTTATTAGTGGATGTCACTAGG + Intergenic
1173491086 20:43482395-43482417 GTGTGGTGGTGCATGCCTGTGGG - Intergenic
1173775498 20:45702929-45702951 GTGTGGTAGCTCATGTGTCTGGG + Intronic
1173850945 20:46217417-46217439 GTGTGTGTGTGAATGTATCTGGG - Intronic
1174283255 20:49454423-49454445 GTAAGTTAGTGCACTTCTCTAGG - Intronic
1174691299 20:52509056-52509078 GTTTGTTATTGCCTGTCTTTTGG - Intergenic
1175896316 20:62337098-62337120 GTGTGTTAGTGCACGTGTAGTGG - Intronic
1176176891 20:63732289-63732311 GTGTGTGTGTGCATGTGTGTGGG + Intronic
1176176900 20:63732346-63732368 GTGTGTGTGTGCATGTGTCAGGG + Intronic
1176275616 20:64265928-64265950 CTGTGTTACTGTATGTCACTGGG + Intronic
1176652958 21:9566552-9566574 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1176726938 21:10445311-10445333 AGATGATAGTGCATGTCTCTGGG - Intergenic
1178324462 21:31632501-31632523 GTGTGGTGGTGCATGCCTGTGGG + Intergenic
1179191441 21:39125671-39125693 GTGTGTGAGTACATGTGTGTTGG - Intergenic
1179393209 21:41012572-41012594 GTGTGTGAGTGAATGTGTGTGGG - Intergenic
1180172842 21:46069016-46069038 GTGTGTCTGTGCATGTCCCTGGG + Intergenic
1180287455 22:10761775-10761797 AGATGATAGTGCATGTCTCTGGG + Intergenic
1180578210 22:16801403-16801425 GTGTGGTGGTGCATGCCTGTAGG + Intronic
1183103947 22:35602652-35602674 CTGTGTGTGTGCGTGTCTCTGGG - Intergenic
1183474503 22:38028604-38028626 GTATGCACGTGCATGTCTCTGGG + Intronic
1184077921 22:42195221-42195243 GAGTTTCAGTGTATGTCTCTGGG - Intronic
1184940720 22:47762768-47762790 GTGGGTTGGTTGATGTCTCTGGG + Intergenic
949934747 3:9108051-9108073 GTGTGTTAGTGGAGGACTGTAGG + Intronic
951045742 3:18036277-18036299 CTGTGTTAGGACATGGCTCTTGG + Intronic
951258804 3:20482330-20482352 GTGGGCTGGTGCATGTCTGTGGG - Intergenic
951270861 3:20622281-20622303 ATTTGTTAGTGCTTGTCTTTTGG + Intergenic
953412908 3:42700328-42700350 GTGTGTTTGTGTGTGTGTCTGGG + Intronic
953551954 3:43909908-43909930 GGGTGTTGGTGCATGCCTGTAGG + Intergenic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
955323730 3:57993687-57993709 GTATGGTGGTGCATGTCTGTAGG + Intergenic
955367721 3:58325980-58326002 GTGTGGTGGTGCATGCCTGTAGG - Intergenic
957436855 3:80188543-80188565 GTGTGGTGGTGCATGCCTGTGGG - Intergenic
957528155 3:81404347-81404369 GTGTCTTATTGCTTCTCTCTTGG - Intergenic
958849674 3:99309163-99309185 GTATGTGAGTCTATGTCTCTTGG + Intergenic
959041230 3:101424797-101424819 GTGGCCTAGTGCATGTCTGTTGG - Intronic
961006584 3:123409797-123409819 GTGAGTGAGGGAATGTCTCTGGG - Intronic
961406554 3:126683791-126683813 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961406557 3:126683817-126683839 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961666237 3:128494642-128494664 GTGTGTATGTGCATGTATCTAGG + Intergenic
965224305 3:165968692-165968714 GTGTGTTAGTGAAGGATTCTGGG - Intergenic
965242298 3:166217565-166217587 GTGTGGTGGTGCATGCCTGTAGG - Intergenic
965808623 3:172568947-172568969 GTTTGTTACTGCGTGTCTTTTGG + Intergenic
966305396 3:178527767-178527789 GTGTGTGTGTGCATGATTCTAGG - Intronic
968447586 4:660031-660053 GTGTGTGCCTGCATGTCTGTGGG + Intronic
968830663 4:2931674-2931696 GTGTGTTAGTGCAGGGCACCCGG + Intronic
968955089 4:3714574-3714596 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
968961460 4:3746886-3746908 GTGTGTGTGTGTGTGTCTCTGGG + Intergenic
969514610 4:7639440-7639462 GTGTGTGAGTGCATGTGTGTGGG + Intronic
969514668 4:7639997-7640019 GTGTGAAAGTGCATGTCTGTGGG + Intronic
969800890 4:9564367-9564389 GTGTGTGTGTGCATGTATGTAGG - Intergenic
971154902 4:24071207-24071229 GTGTGTTTGTGCATGCATGTGGG - Intergenic
971558536 4:28044319-28044341 ATGTGTTAGTACCTGTCTTTTGG + Intergenic
972033332 4:34490315-34490337 GTGTGTGAGTGCTTGTTTCTGGG + Intergenic
972064254 4:34920105-34920127 GTCAGTTAGTTAATGTCTCTTGG - Intergenic
972383967 4:38545673-38545695 GTTTGTTATTGCCTGTCTTTTGG + Intergenic
972867171 4:43246874-43246896 ATTTGTTACTGCATGTCTTTTGG + Intergenic
972940522 4:44189638-44189660 GTGTGTGTGTGCATGTATGTTGG - Intronic
972962198 4:44467356-44467378 GTTTGTTATTGCCTGTCTTTTGG - Intergenic
973161463 4:47022633-47022655 GTTTGTTATTGCCTGTCTTTTGG - Intronic
973307652 4:48671107-48671129 GTTTGTTACTGCCTGTCTTTTGG + Intronic
973617176 4:52690762-52690784 GTGTGGTGGAGCATGTCTTTTGG - Intergenic
974653537 4:64786849-64786871 GTGTGGGTGTGCATGTCTGTCGG + Intergenic
974998883 4:69196174-69196196 GTGTGTGTGTGCATGTATCGGGG + Intronic
975358249 4:73433660-73433682 GTGAGTTAATTCATTTCTCTGGG - Intronic
976180352 4:82393008-82393030 GTGTGTTGGTGCGTGCCTGTAGG + Intergenic
976337956 4:83912464-83912486 GTGTGTGTGTGCATGTGTATTGG - Intergenic
976563512 4:86528679-86528701 GTGTGGTGGTACATGCCTCTAGG - Intronic
976681644 4:87763599-87763621 ATTTGTTATTGCATGTCTTTTGG - Intergenic
976689763 4:87856097-87856119 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
976762260 4:88562155-88562177 ATGTGTTATTGCCTGTCTTTTGG + Intronic
977054701 4:92176936-92176958 GTGTGTGTGTGCATTTCCCTGGG + Intergenic
977249228 4:94670807-94670829 GTTTGTTTGTGCCTGTATCTGGG + Intergenic
977261174 4:94799025-94799047 GTGCGTTAGTGTGTGTTTCTTGG + Intronic
978100528 4:104834841-104834863 GTATGTGAGTGTATGTGTCTAGG - Intergenic
978708966 4:111753670-111753692 GTGTGTGTGTGCATGCCTGTGGG - Intergenic
979422478 4:120522455-120522477 GTTTGTTATTGCCTGTCTTTTGG - Intergenic
981039271 4:140207966-140207988 ATTTGTTATTGCCTGTCTCTTGG + Intergenic
981203278 4:142009121-142009143 ATGTGTTATTGCCTGTCTTTTGG + Intergenic
981377907 4:144037341-144037363 GTGTCCTAGTGCATCTCTCAGGG + Intergenic
981599982 4:146476499-146476521 GTGTGCATGTGCATGTGTCTTGG + Intronic
981817413 4:148847006-148847028 GTGTGTGTGTGTATGTATCTTGG + Intergenic
982271715 4:153596595-153596617 GAGTGTGCGTGCATGTCTCCAGG + Intronic
982840079 4:160173456-160173478 GTGTGTTTGTGTATGTGTGTTGG + Intergenic
984592970 4:181636982-181637004 GTGTGTAAGTGGAAGTTTCTCGG - Intergenic
985265169 4:188150265-188150287 GTGTGGTGGTGCATGCCTATGGG - Intergenic
986359361 5:6961093-6961115 GTGTGTTTGTGCATGCGTTTGGG - Intergenic
986925620 5:12745054-12745076 GTGTGTGTGTGCATGTGTATGGG + Intergenic
987538047 5:19213961-19213983 ATTTGTTATTGCATGTCTTTTGG - Intergenic
987655793 5:20804238-20804260 GTGTGTGCGTGCATGTATGTAGG + Intergenic
988569392 5:32349333-32349355 GTGTGGTGGTGCATGCCTGTAGG - Intergenic
988767761 5:34399670-34399692 GTGTGTGCGTGCATGTATGTAGG - Intergenic
988935769 5:36081586-36081608 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
989289772 5:39749573-39749595 GTGTGTCAGTGCTTGTCTCTTGG - Intergenic
990332779 5:54744094-54744116 CAGTGTTTGTGCATCTCTCTGGG + Intergenic
990593474 5:57290297-57290319 GTTTGTTATTGCCTGTCTTTTGG - Intergenic
990747272 5:58971906-58971928 GTGCATTAGTCCCTGTCTCTTGG + Exonic
990763293 5:59154315-59154337 GTGTGTGTTTGCATGTCTGTGGG + Intronic
990922776 5:60985978-60986000 GTGTGTTGTTGCCTGTCTTTTGG - Intronic
992054059 5:72969917-72969939 TTGTGATAGTGCTTGTCACTTGG + Intronic
993121538 5:83780307-83780329 GTGTGTTATGACATGTTTCTGGG + Intergenic
994671665 5:102769007-102769029 GTTTGTTACTACATGTCTTTTGG + Intronic
994891563 5:105642203-105642225 ATTTGTTATTGCCTGTCTCTTGG - Intergenic
994893144 5:105665267-105665289 GTGTGTTATTGCCTGTCTTTTGG + Intergenic
995311111 5:110712740-110712762 ATTTGTTATTGCATGTCTTTTGG - Intronic
995432344 5:112094805-112094827 GTTTGTTATTGCCTGTCTTTTGG - Intergenic
995780602 5:115771203-115771225 GTGTGGTAGTGCATACCTGTAGG + Intergenic
996228430 5:121031164-121031186 CTGTGTGAGAGCATGTCTTTGGG - Intergenic
996616450 5:125447188-125447210 ATGTGTTTGTGCATTTCTGTTGG - Intergenic
996688236 5:126308890-126308912 GTTTGTTATTGCCTGTCTTTTGG - Intergenic
997646897 5:135487886-135487908 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
998417641 5:141957347-141957369 GGGTGTTAGGGCCTGTGTCTGGG + Exonic
998811270 5:145968480-145968502 ATGTGTTTGTGCATGTATGTGGG + Intronic
998934065 5:147215851-147215873 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
999210579 5:149885030-149885052 GTGTGTTTGTGGCTTTCTCTGGG - Intronic
999252756 5:150192399-150192421 GTGTGTTCCTGCATGCCCCTGGG + Intronic
999354667 5:150914929-150914951 GTGTGTGAGATCATCTCTCTTGG - Intergenic
1000574858 5:162965118-162965140 GTGTGGTGGTGCATGTCACCAGG - Intergenic
1001533918 5:172485234-172485256 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1002776922 6:336272-336294 GTGTGTTACTGCATGTCACAGGG + Intronic
1002931757 6:1639737-1639759 GTGTGGTGGTGCATGCCTGTAGG + Intronic
1003169568 6:3710489-3710511 GTGTGTGAGTGCCTATGTCTGGG + Intergenic
1003284079 6:4719060-4719082 GTGTGGTGGTGCATGCCTGTAGG - Intronic
1003603309 6:7538647-7538669 GTGTGTATGTGCATGTGTGTGGG + Intergenic
1004867301 6:19866786-19866808 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1006876771 6:37304329-37304351 ATATGTTTGTGCATGTCTTTTGG - Intronic
1008248645 6:49209327-49209349 GTGTGTGTGTGCGTGTGTCTGGG - Intergenic
1008589663 6:52981293-52981315 GAGAGTTAGTGTATCTCTCTTGG + Intronic
1008836508 6:55838300-55838322 GTTTGTTATTGCCTGTCTTTTGG + Intronic
1010867410 6:80996093-80996115 ATTTGTTATTGCTTGTCTCTAGG + Intergenic
1011233901 6:85193626-85193648 GTGTGTGTGTGTATGTCTGTTGG - Intergenic
1011581100 6:88866289-88866311 GTGTGTAAGTGCATGCTACTTGG - Intronic
1011595298 6:89010230-89010252 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1012287915 6:97415723-97415745 GTTTGTTATTGCCTGTCTTTTGG + Intergenic
1012712462 6:102624951-102624973 GTGTGTTATTGCCTATCTTTTGG + Intergenic
1015577958 6:134692754-134692776 GTGTGTTTGTGTATGTGTCAGGG - Intergenic
1016748564 6:147608120-147608142 ATGTGTTATTGCCTGTCTTTTGG - Intronic
1018424208 6:163665291-163665313 GTGTGTCTGTGTGTGTCTCTGGG - Intergenic
1018843690 6:167539027-167539049 ACGTGTGAGTGCATGTCTTTTGG - Intergenic
1020017129 7:4837660-4837682 GTGTGTGGGTGCATGTGTGTTGG - Intronic
1021239244 7:18180216-18180238 GTGTGTGTGTGTATGTGTCTTGG - Intronic
1021280320 7:18708919-18708941 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1023716632 7:43051520-43051542 GTTTGTTATTGCCTGTCTTTTGG - Intergenic
1023810700 7:43909193-43909215 GTGTGTTTGTGTATGTGTGTAGG - Intronic
1024415524 7:49101121-49101143 ATGTGTAAGTGCATGTCACAGGG - Intergenic
1024854036 7:53755874-53755896 GTGTGTGTGTGCATGTGTCTGGG - Intergenic
1025279298 7:57615273-57615295 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1025305433 7:57850227-57850249 GTGTGGGAGTGCATGTTTCAGGG - Intergenic
1026247224 7:68631893-68631915 ATTTGTTATTGCCTGTCTCTTGG + Intergenic
1026324481 7:69296987-69297009 GCATGGTAGTGCATGTCTGTAGG + Intergenic
1026895268 7:74006739-74006761 GTGCGTTAGTGGAGGTCACTGGG - Intergenic
1027054441 7:75040319-75040341 GCGTGGTAGTGCATGCCTCTAGG + Intronic
1027749190 7:82120199-82120221 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1027852683 7:83468688-83468710 GTGTGTTAGGGACTGTGTCTGGG + Intronic
1030616591 7:111743956-111743978 GTGTGGTGGTGCATGCCTGTAGG - Intronic
1030655628 7:112164145-112164167 GTGTGGTGGCGCATGCCTCTAGG + Intronic
1031516301 7:122703262-122703284 ATGTATTAGTGCATGTACCTGGG + Intronic
1031907434 7:127475997-127476019 GTGTGTGTCTGCATGTCTATGGG - Intergenic
1032003684 7:128283375-128283397 GTGTGGTGGTGCATGCCTGTAGG - Intergenic
1032589103 7:133176060-133176082 GTATGGTGGTGCATGTCTCTGGG + Intergenic
1033238827 7:139660157-139660179 GGGTGTTATTGTCTGTCTCTTGG + Intronic
1033270209 7:139924310-139924332 TTGTGTTATTGCCTGTCTTTTGG + Intronic
1034032538 7:147784097-147784119 CTCTCTTTGTGCATGTCTCTGGG + Intronic
1034480072 7:151313016-151313038 GAGTGTCAGTGCATGTGTGTGGG + Intergenic
1034480095 7:151313218-151313240 GTATGTCAGTGCATGTATGTGGG + Intergenic
1034480122 7:151313464-151313486 GTGTTTGAGTGCATGTGTATGGG + Intergenic
1034480152 7:151313671-151313693 GTGTGTGAGTGCATGTGTATGGG + Intergenic
1034683719 7:152951268-152951290 TTGTGATAGTGAATGTCTCATGG + Intergenic
1034937154 7:155207664-155207686 GTGTGGGAGTGCATGTGTGTGGG + Intergenic
1035019698 7:155793655-155793677 GTGTGTGAATGCATGTGTGTGGG - Intergenic
1035112945 7:156499404-156499426 GTGTGTGTGTGTCTGTCTCTGGG - Intergenic
1036664042 8:10727329-10727351 GTGTGTGCATGCATGTGTCTGGG - Intronic
1037315068 8:17592905-17592927 GTGTGTGTGTGCATGTATGTGGG - Intronic
1038023091 8:23566483-23566505 GTGTGTGCGTGCGTGTGTCTGGG - Intronic
1038355433 8:26824805-26824827 GTGTTTAAGTGACTGTCTCTGGG - Intronic
1038578774 8:28728746-28728768 GTGTGGTGGTGCATGCCTGTAGG + Intronic
1039674162 8:39641517-39641539 GTGTGTTGTTCCATGTGTCTAGG + Intronic
1041365937 8:57104888-57104910 ATGTGTTATTGCCTGTCTTTTGG - Intergenic
1042163190 8:65919252-65919274 GTTTGTTATTGCCTGTCTTTTGG - Intergenic
1046475261 8:114733921-114733943 GTGTGTTATTGCATGTGACATGG - Intergenic
1046918937 8:119707016-119707038 GTGTGGTGGTGCATGCCTGTGGG - Intergenic
1046967592 8:120184745-120184767 GTGTTTTAGTTCAAGTCTCAAGG + Intronic
1047117404 8:121859266-121859288 GTGTGTGATTGTATGTGTCTCGG - Intergenic
1047333377 8:123913095-123913117 GTGTTTTATTGCTTGTTTCTGGG + Intronic
1047585861 8:126271558-126271580 GTGTGGTGGTGCATGTCTGTAGG + Intergenic
1047797079 8:128268497-128268519 ATTTGTAAGTGCATATCTCTGGG + Intergenic
1049159497 8:141088253-141088275 GTGTGTGTGTGCATGTGTATGGG - Intergenic
1049510119 8:143023043-143023065 GTGTGTTTGTTCATTTCTCCGGG + Intronic
1050851114 9:10287588-10287610 TTGTGTTATTGCATTTCTCATGG - Intronic
1052744733 9:32429389-32429411 GTGTGTGTGTGCTTCTCTCTTGG + Intronic
1055830681 9:80374976-80374998 GTGCTCTAGTGCATGTCTCTAGG + Intergenic
1056779663 9:89539692-89539714 GTGTGTGTGTGCATGTCTGTGGG + Intergenic
1058665474 9:107310568-107310590 GTGTCATAGTGGTTGTCTCTGGG + Intronic
1058934114 9:109752105-109752127 GTGCTGTAGTGCATATCTCTTGG + Intronic
1059553759 9:115257233-115257255 GTGTGTCTGTGCATGTTTGTGGG - Intronic
1059945552 9:119405213-119405235 GTGTATGTGTGCATGTCTCAGGG - Intergenic
1060116587 9:120946190-120946212 GTGTGTATGTGCATGTTTCTGGG + Intergenic
1060492964 9:124098414-124098436 GTGTGTTTGAGCACGTGTCTGGG + Intergenic
1061005187 9:127924901-127924923 GTGTGTGCGTGCATGTGTGTGGG - Intronic
1061209963 9:129185667-129185689 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1061245516 9:129399505-129399527 GTGTGCATGTGCATGTCTGTGGG - Intergenic
1203630687 Un_KI270750v1:70093-70115 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1185615129 X:1417112-1417134 GTGTCTGTGTGCATGTGTCTGGG - Intronic
1187106023 X:16242808-16242830 GTTTGTTATTGCCTGTCTTTTGG + Intergenic
1187239670 X:17501223-17501245 GTGTGGTGGTGCATGCCTGTGGG + Intronic
1189363853 X:40373235-40373257 GTGTGTATGTGCATGTGTATAGG + Intergenic
1189750600 X:44217204-44217226 ATTTGTTATTGCCTGTCTCTCGG - Intronic
1189942859 X:46144418-46144440 ATTTGTTATTGCCTGTCTCTTGG - Intergenic
1190276177 X:48901101-48901123 GAATGTGAGTGCGTGTCTCTAGG + Intronic
1192213996 X:69145248-69145270 TTCTGTTTGTGCTTGTCTCTAGG - Intergenic
1193219510 X:78906642-78906664 GTTTGTTATTGCCTGTCTTTTGG + Intergenic
1193461300 X:81793577-81793599 GTGTGGGAGTCTATGTCTCTAGG - Intergenic
1193497611 X:82233609-82233631 GTGTGTGTGTGCATGTCTGCTGG + Intergenic
1193891141 X:87047013-87047035 GAGTGTTAGAGAATGTCTTTAGG - Intergenic
1194327381 X:92536622-92536644 ATTTGTTATTGCCTGTCTCTTGG + Intronic
1194942208 X:100024725-100024747 GTTTGTTATTGCCTGTCTTTTGG - Intergenic
1195133221 X:101875659-101875681 ATTTGTTATTGCCTGTCTCTTGG - Intergenic
1195934743 X:110114195-110114217 GTGTGTTTGTGCATTTATCAAGG - Intronic
1196385616 X:115145772-115145794 GTATGTTATTGCCTGTCTTTTGG - Intronic
1197362740 X:125526734-125526756 GTTTGTTATTGCCTGTCTTTTGG + Intergenic
1199881594 X:151977714-151977736 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1200427583 Y:3038537-3038559 GTTTGTTATTGCCTGTCTTTTGG - Intergenic
1200636098 Y:5655845-5655867 ATTTGTTATTGCCTGTCTCTTGG + Intronic
1201965900 Y:19735390-19735412 TTGTCTTAGTGCAGGGCTCTAGG + Exonic