ID: 1115630853

View in Genome Browser
Species Human (GRCh38)
Location 14:35243681-35243703
Sequence AACCTAGTTCTGCTACTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 335}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115630853 Original CRISPR AACCTAGTTCTGCTACTTAC TGG Intronic
900865835 1:5268000-5268022 ATCCTAGTTCTGACACTTGCAGG + Intergenic
901518813 1:9768087-9768109 ATCGTAGCTCTGCTACTTATTGG - Intronic
901614404 1:10526864-10526886 AATCAAGATCTGCTACTAACGGG - Intronic
902408667 1:16200214-16200236 ATCCCAGTTCTGCCGCTTACTGG + Intronic
902785716 1:18731426-18731448 ATCCCAGCTCTGCCACTTACCGG + Intronic
903630881 1:24769479-24769501 ATCACAGTACTGCTACTTACTGG - Intronic
903666807 1:25013025-25013047 ATCCCAGCTCTGCCACTTACCGG - Intergenic
903934988 1:26889532-26889554 AATCTGGCTCTGCTACTGACTGG - Intronic
904280121 1:29413173-29413195 AACCCAGCTCTGCCACTCACAGG - Intergenic
904291637 1:29489844-29489866 ATCCCAGTTCTGCCACTTACTGG + Intergenic
904608605 1:31712878-31712900 ATCCTGGCTCTGCTACTTCCTGG + Intergenic
904791398 1:33024638-33024660 AACCTGGCCCTGCCACTTACTGG + Intronic
904894489 1:33803997-33804019 ATCCCAGTTCTGCCACTTACTGG + Intronic
905089963 1:35422687-35422709 AGCCTAGTGTTTCTACTTACTGG + Intergenic
905542578 1:38772156-38772178 AACCTGGTTCTGCCACTTCCTGG - Intergenic
905766124 1:40602594-40602616 ACCCTGGCTCTGCCACTTACTGG + Intergenic
906477380 1:46178774-46178796 ATCCTGGCTCTGCCACTTACAGG + Intronic
906780775 1:48571214-48571236 ATCCTAGTTTTGCCACTTCCAGG - Intronic
906822878 1:48947691-48947713 AACATACTCCTGCTACTTCCAGG + Intronic
907173290 1:52492596-52492618 ATTTTAGTTCTGCCACTTACTGG - Intronic
907391519 1:54161346-54161368 ATCCTGGTTCTGCCACTTAGAGG - Intronic
907759600 1:57344145-57344167 AACTTGGTTCTGCCATTTACTGG - Intronic
908124712 1:61018864-61018886 ATCCTGGTTCTGCCACTTACTGG - Intronic
908528370 1:65009800-65009822 ATCCCAGCTCTGCCACTTACTGG - Intergenic
908816717 1:68042724-68042746 ATCCTGGCTCTGCTACTTACCGG + Intergenic
911173842 1:94798650-94798672 ATCCTAGCTCTGCAACTTCCCGG + Intergenic
912390608 1:109300143-109300165 ATCCTTGTTCTGGTGCTTACAGG - Intronic
912806733 1:112762667-112762689 AATCTGGTTCTGCCACTTGCCGG + Intergenic
915169227 1:153966306-153966328 ATCTTGGTTCAGCTACTTACAGG + Intronic
915453316 1:156021908-156021930 ATCCCAGTTCTGTCACTTACTGG + Intergenic
916185667 1:162130282-162130304 ATCCTAGTTCTGCCACTTACAGG - Intronic
917468871 1:175308748-175308770 AACCTCTTTCTGCCTCTTACTGG - Intergenic
917626312 1:176850070-176850092 ATCCTGGCTCTGCCACTTACTGG - Intergenic
918140906 1:181718898-181718920 GACCCAGTTCTGCTGCTAACTGG - Intronic
918428470 1:184434632-184434654 AACCCAGTGCTGCCACTCACAGG - Intronic
918479610 1:184964481-184964503 AACCTTCTTCTACTACATACTGG + Intronic
918712873 1:187752828-187752850 ATCCAAGTTCTGACACTTACAGG - Intergenic
918974091 1:191458405-191458427 ACCCTAGATCTGCCACATACTGG - Intergenic
918984448 1:191605696-191605718 ATCCTGGCTTTGCTACTTACTGG + Intergenic
919094224 1:193010466-193010488 ATCCTAGATCTACTACTTACTGG + Intergenic
919572394 1:199265039-199265061 ATCCTGGTTCTACCACTTACTGG + Intergenic
920982683 1:210853152-210853174 CCCCTAGCTCTGCCACTTACTGG + Intronic
922206895 1:223455927-223455949 AGCCCAGCGCTGCTACTTACTGG + Intergenic
922967121 1:229699605-229699627 ATCCTTGCTTTGCTACTTACTGG + Intergenic
923085585 1:230701343-230701365 AACCAATTTCTTCTACTTAGAGG - Intergenic
1063758754 10:9047158-9047180 AACCCAGCTCTTCTACTTCCAGG + Intergenic
1063843967 10:10104384-10104406 TACCTAGTTCTGCTGCCTGCTGG - Intergenic
1064391671 10:14947534-14947556 ATCCTGGTCCTGCCACTTACTGG + Intronic
1065414190 10:25466717-25466739 AACAAAATTCTGTTACTTACTGG - Exonic
1068997659 10:63225943-63225965 AACTTAGTTCTGTGACTTCCAGG + Intronic
1069883970 10:71611665-71611687 ATCATGGGTCTGCTACTTACTGG - Intronic
1070118314 10:73550786-73550808 AATTTAGTTCTGCTAATTTCAGG + Intronic
1070485047 10:76922296-76922318 ATCCTGGTTCTGCTGCTAACTGG - Intronic
1070750796 10:78962923-78962945 ATCCCAGCTCTGCTACCTACTGG + Intergenic
1071463455 10:85919753-85919775 ATCCCAGTTCTGCCACTTCCTGG + Intronic
1071873079 10:89816218-89816240 ATCCTAGATCTACTGCTTACTGG - Intergenic
1072461879 10:95626412-95626434 TACCTAATTCTGCCACATACTGG - Intronic
1072491385 10:95908860-95908882 AACGTAGTTTTGCTACTCAAAGG - Intronic
1073175417 10:101553502-101553524 AAACTAGTTCTTCTGCTTAATGG - Exonic
1074164510 10:110863240-110863262 ATCCTAGTTGTGCTACTAATTGG - Intergenic
1074428103 10:113369971-113369993 CATCTAGTTCTGCCACTTAAGGG - Intergenic
1074739289 10:116469315-116469337 AACTTAGCTATGATACTTACGGG - Exonic
1074893901 10:117758144-117758166 ATCCTGGTTCTGCCACCTACTGG + Intergenic
1075208702 10:120470854-120470876 AACACAAATCTGCTACTTACTGG + Intronic
1077674207 11:4182858-4182880 ATCCCAGCTCTGCTACTTCCTGG - Intergenic
1077789576 11:5423945-5423967 AATGTAGCTCTGCTTCTTACAGG + Intronic
1078137629 11:8664963-8664985 AACCTGTTTCTCCTACTTGCTGG - Intronic
1079099220 11:17530400-17530422 ATCCTGGCTCTGCCACTTACTGG + Intronic
1079305532 11:19317993-19318015 ATCCTAGCTCTGCCACTTACTGG + Intergenic
1080250328 11:30226559-30226581 ACCCCAGCTTTGCTACTTACAGG + Intergenic
1080308930 11:30867296-30867318 ATCCCAGTTCTGCCACTTATTGG + Intronic
1080684058 11:34501100-34501122 CTCCTAGCTCTGCCACTTACGGG - Intronic
1081670086 11:44937866-44937888 AGCCTGGTCCTGCCACTTACCGG + Intronic
1081912905 11:46711579-46711601 GTCCTGGTTCTGCTACTGACTGG - Intergenic
1084687057 11:70702837-70702859 AACCCAGCTCTGCCACTTACTGG + Intronic
1084893625 11:72249976-72249998 AACCTAGTACTGCAACTGGCAGG - Intergenic
1085299996 11:75452266-75452288 ATCCTGGCTCTGCTACCTACTGG + Intronic
1085718983 11:78896793-78896815 ACCCTGGTTCTGCCACTTACTGG + Intronic
1085770416 11:79320588-79320610 AACCTGGCTCTGCCATTTACTGG - Intronic
1085951454 11:81337394-81337416 TCCCTAGATGTGCTACTTACTGG - Intergenic
1085969891 11:81575363-81575385 AATCTAGTTCTACCACTTCCTGG + Intergenic
1086048007 11:82555782-82555804 ATTCTAGTCCTGCTACTTGCTGG - Intergenic
1086141915 11:83508786-83508808 ATCCCAGTTCTGCCACTTGCCGG - Intronic
1086164192 11:83758536-83758558 AACCCAGCACTGCTACTTAATGG + Intronic
1086269863 11:85049549-85049571 AACCTAGTGCAGATAATTACTGG - Intronic
1086416483 11:86593503-86593525 GATCCAGTTCTGCAACTTACTGG - Intronic
1087658815 11:100961259-100961281 ATCCTAGCTCAGCCACTTACAGG + Intronic
1088157750 11:106829406-106829428 AGCCTAGTTCCACTACTTGCTGG + Intronic
1088437587 11:109832303-109832325 ATCCTATCTCTCCTACTTACTGG - Intergenic
1088609720 11:111565493-111565515 GTCCTATTACTGCTACTTACTGG + Intergenic
1088720056 11:112584408-112584430 GACCTAGTTCTGCTCCTTGTGGG + Intergenic
1088929252 11:114333182-114333204 AACCTAGTTTTGCTGCTCAGGGG - Intergenic
1089283910 11:117393608-117393630 ATCCTAGCTCTTCTACTTATTGG - Intronic
1089372372 11:117970590-117970612 ATCTCACTTCTGCTACTTACTGG - Intergenic
1089488126 11:118862961-118862983 ATCCCAGTTCTGCTACTTATTGG + Intergenic
1089745126 11:120611251-120611273 ATCCTAGCTCTGCTGATTACTGG + Intronic
1090006888 11:123010727-123010749 ATCCCAGTTCTGCTATTTATTGG - Intergenic
1090917938 11:131182813-131182835 ATCCCAGCTCTGCTACTTACTGG + Intergenic
1091168873 11:133503182-133503204 AACCTAACTCTGCTACTTAAAGG - Intronic
1091825001 12:3505685-3505707 ATTCCAGCTCTGCTACTTACTGG - Intronic
1092126341 12:6077527-6077549 AGCCCAGCTCTGCCACTTACTGG + Intronic
1094531032 12:31275131-31275153 ATCCTGGTTTTGCTACTTACTGG - Intergenic
1094764963 12:33583839-33583861 ATACAAGTTCTGCTACTTACTGG - Intergenic
1097144500 12:56930533-56930555 AACCAAGTTCTGCTCCCCACCGG + Intronic
1097262996 12:57729963-57729985 ATCCTGGTTCTGCCACTTACTGG + Intronic
1099218662 12:79885174-79885196 AATCCAGTTCTGCCATTTACTGG + Intronic
1100079397 12:90829152-90829174 ATCCCAGTTCTGCCACTGACTGG + Intergenic
1100757038 12:97762833-97762855 AACCTGGCTCTACCACTTACTGG - Intergenic
1101406784 12:104435796-104435818 TTCCTAGTTCTACCACTTACTGG - Intergenic
1101511849 12:105400355-105400377 ATCCCAGTTCTTTTACTTACTGG + Intergenic
1101795102 12:107965835-107965857 AACTGAATTCTGCTACCTACTGG - Intergenic
1102241116 12:111325489-111325511 ATCCTAGGTCTGCCACTCACTGG - Intronic
1102448910 12:113025943-113025965 GACCTAGTTCTCCTATTTCCTGG - Intergenic
1103217810 12:119216254-119216276 ATCCTATTTCTGCTGCTGACTGG + Intronic
1108094894 13:46891305-46891327 ATCCTTGTTGTGCTACTTACTGG + Intronic
1109316526 13:60755940-60755962 ATTCTGGTTCTGCAACTTACAGG - Intergenic
1111187894 13:84764704-84764726 CTCTGAGTTCTGCTACTTACTGG - Intergenic
1111239335 13:85454688-85454710 AAACTACTTATGCTCCTTACTGG - Intergenic
1113965691 13:114152312-114152334 AACCATGGTCTGCTACTTGCTGG - Intergenic
1115429207 14:33297173-33297195 ATCCTAGCTCTGCCATTTACTGG + Intronic
1115604779 14:34989967-34989989 ATCCTAGCTCTGTTACATACTGG - Intronic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1116140603 14:40988965-40988987 AACCTAATTATGCTTCTTAAAGG - Intergenic
1117903101 14:60555959-60555981 GTCCTAGTTCTGGTACTTGCAGG + Intergenic
1118416444 14:65541967-65541989 ATTCTGGTTCTGCTACTTACTGG + Intronic
1118611311 14:67542438-67542460 AACTTGGCTCTGCCACTTACTGG + Intronic
1118760429 14:68877678-68877700 ATCCCAGTTCTGCTGCTTCCTGG - Intronic
1119702358 14:76763641-76763663 ATCTCAGTTCTGCCACTTACTGG - Intronic
1119851566 14:77870245-77870267 ATCCTGGTTCTGCTTCTTACTGG - Intronic
1120067329 14:80058298-80058320 ATCCTGGTTTTGCTGCTTACTGG - Intergenic
1120358332 14:83462005-83462027 AAGCCAGTTTTGCTATTTACCGG + Intergenic
1120815548 14:88853604-88853626 ATTCTTGTTCTGCCACTTACTGG - Intronic
1121258311 14:92548309-92548331 ATCCCAGTTCTGCCACTTATTGG + Intronic
1121584784 14:95055770-95055792 ATCCTGGCTCTGCTCCTTACAGG + Intergenic
1121844029 14:97157721-97157743 ATCCCATTTCTGCTACTTCCTGG + Intergenic
1124901548 15:33827781-33827803 ATCCTGGTTCTGCCACTTACTGG + Intronic
1125098826 15:35886293-35886315 ATCTTGGTTCTGCTACTGACTGG + Intergenic
1125768795 15:42151798-42151820 ACCCTGGCTCTACTACTTACTGG + Intronic
1126222090 15:46225823-46225845 TACCTAGTTCTGCTAGTTCTAGG - Intergenic
1126869878 15:52976443-52976465 AACCTAGCTCAGCTACTTTCTGG - Intergenic
1128049339 15:64649826-64649848 CACCTAGTTCTGCTACCTTGAGG + Intronic
1128353267 15:66906212-66906234 ATCCTTCCTCTGCTACTTACTGG + Intergenic
1128581843 15:68816325-68816347 ATCCTGGTTCTGCCACTCACTGG + Intronic
1128648723 15:69395354-69395376 ATCCTAGCTCTGCTTCTTATTGG + Intronic
1129484867 15:75860997-75861019 ATCTTTGTTCTGCTACTTACTGG + Intronic
1129490381 15:75919494-75919516 ACTCTAGTTCTGCTACTTTCTGG + Intronic
1129628454 15:77230877-77230899 AACCAAATTATGCTTCTTACTGG - Intronic
1129667147 15:77585589-77585611 ATCCTCACTCTGCTACTTACTGG + Intergenic
1129748222 15:78039849-78039871 ATCCCAGTCCTGCTACTTATTGG - Intronic
1129951367 15:79594685-79594707 AACCCATTTCTGAAACTTACTGG + Intergenic
1130406262 15:83604788-83604810 TACCCAGCTCTGCTACTTCCTGG - Intronic
1130526832 15:84714602-84714624 GAAGTAGCTCTGCTACTTACTGG - Intronic
1131990315 15:98086764-98086786 ATCCTGGCTTTGCTACTTACGGG - Intergenic
1133152224 16:3843194-3843216 AGCCTGGTTCTGCCACTCACTGG + Intronic
1134811496 16:17170879-17170901 GTCCTAGTTCTACTACTTATTGG + Intronic
1135185828 16:20314993-20315015 ATCCCAGCTCTGCTACTGACTGG - Intronic
1135210362 16:20520859-20520881 ATTCCAGTTCTGCCACTTACTGG + Intergenic
1135796170 16:25444952-25444974 ATCCTGGCTCTGCCACTTACTGG - Intergenic
1136047949 16:27630183-27630205 AACCCTGTTCTGCCACTTTCTGG + Intronic
1136090434 16:27915881-27915903 ATTCTGGTTCTGCCACTTACCGG + Intronic
1137540770 16:49360166-49360188 AAGCTAGTCCTGCTCCATACTGG - Intergenic
1138147711 16:54627259-54627281 AACCCAGTTCTGCTGCCTTCTGG - Intergenic
1138276529 16:55738838-55738860 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138282454 16:55782196-55782218 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138286494 16:55814447-55814469 AGCCTGGCTCTGCTACTTACTGG + Intronic
1138542220 16:57695330-57695352 ATCCCAGACCTGCTACTTACTGG + Intronic
1139787462 16:69405412-69405434 AATCTAGCTCTGTTACTTGCTGG - Intronic
1142055560 16:87993462-87993484 AATCTAGTTCTGCTTCATTCTGG + Intronic
1142374467 16:89700124-89700146 GACTTAGTTCTGCTGCTTCCTGG - Intronic
1142635129 17:1252443-1252465 AAGCTATTTCTGCTAATCACAGG - Intergenic
1143701514 17:8664114-8664136 ATCCTAGTTCTCCCACTTCCTGG - Intergenic
1143893800 17:10121439-10121461 GGCCTGGTTCTGCTACTCACTGG + Intronic
1144220508 17:13095507-13095529 AGCCTGGTTCTACTTCTTACTGG + Intergenic
1144249303 17:13399630-13399652 AATCTGGGTCTGCCACTTACTGG - Intergenic
1144403261 17:14927245-14927267 ACCCTAGTTCTTCTACTTACTGG + Intergenic
1144959211 17:19035474-19035496 ATGCTAGTTCTGCCACTTCCTGG - Intronic
1144975948 17:19139050-19139072 ATGCTAGTTCTGCCACTTCCTGG + Intronic
1146131136 17:30276339-30276361 ATCCTAATTCTGCCATTTACTGG - Intronic
1146570434 17:33948052-33948074 ATCCTGATTCTGCCACTTACAGG - Intronic
1146668849 17:34723062-34723084 AGCCTGATTCTGCTACTTCCAGG - Intergenic
1147055125 17:37828162-37828184 AAGCTGCTTCTGCTACTTAAGGG + Intergenic
1147127442 17:38381590-38381612 ATCCTGGTTCTGCAACTCACTGG - Intronic
1147266759 17:39238960-39238982 ATCTCAGTTCTGCTACTTGCTGG - Intergenic
1149003619 17:51781962-51781984 ATCCCAGTCCTGCCACTTACTGG - Intronic
1151911771 17:77088289-77088311 AACCCAGCTCTGCCACTTCCTGG + Intronic
1153095243 18:1393781-1393803 GTCCTGGTTCTTCTACTTACTGG - Intergenic
1153873406 18:9342187-9342209 GATCCAGTTCTGCCACTTACTGG + Intronic
1154329364 18:13417020-13417042 AAGCTGGCTCTACTACTTACTGG - Intronic
1155148812 18:23106057-23106079 AGACTGGTTCTGCTACTTCCAGG + Intergenic
1156214945 18:34988386-34988408 AAACTGGTTCTGCTGCTAACTGG + Intronic
1157933026 18:51844008-51844030 CACCTAGTTTTGATAATTACTGG - Intergenic
1158268494 18:55686487-55686509 GTCCTAGTTCTGTTACTAACTGG - Intergenic
1158535377 18:58303822-58303844 ATCCTAGTCCTGCCACTTTCTGG + Intronic
1158676424 18:59523377-59523399 AACCTGGGTCTGTTTCTTACTGG + Intronic
1159380777 18:67655602-67655624 ATTCTAGTTCTGATGCTTACTGG + Intergenic
1159491281 18:69138360-69138382 ATCTTATCTCTGCTACTTACTGG - Intergenic
1162922312 19:13910462-13910484 ATCCGAGCTCTGCCACTTACTGG + Intronic
1166726716 19:45032878-45032900 ATCCTGGCTCTGCTGCTTACTGG + Intronic
1167135926 19:47615508-47615530 ATCCCAGTTCTGCTATTTGCTGG + Intronic
1167565765 19:50255679-50255701 ATCCCAGCTCTGCCACTTACTGG - Intronic
1167812971 19:51851332-51851354 AATCTATTTCTGCTACTCATTGG - Intergenic
926490284 2:13517401-13517423 ACTCTAGGTCTGCTGCTTACCGG - Intergenic
926579011 2:14614387-14614409 AAGCTAGATCTGCTCTTTACTGG + Intergenic
926691566 2:15738116-15738138 ATCCCAGCTCTGCCACTTACTGG + Intronic
926802276 2:16669040-16669062 ATCCTAATTCTGCCACTCACTGG + Intergenic
926961211 2:18360362-18360384 ATCCCAGCTCTGCTTCTTACTGG + Intronic
927123167 2:19988114-19988136 ATCCTTGTTCCGCCACTTACTGG + Intronic
927493736 2:23538132-23538154 ATCCTAGTTCTGCTACTTATTGG - Intronic
927727707 2:25439680-25439702 ATCCTAGCTTTGCTACTTTCTGG + Intronic
928620472 2:33083224-33083246 AGGCTAGTTCTGCTGCTTTCAGG + Intronic
930080600 2:47444658-47444680 ATCCCAGCTCTGCTACCTACTGG - Intronic
930084818 2:47488757-47488779 ATCCCAGCTCTGCCACTTACTGG - Intronic
930784036 2:55253074-55253096 ATCCTGGCTATGCTACTTACTGG + Intronic
932124780 2:69133902-69133924 ATCATGGTTCTGCTGCTTACAGG + Intronic
932286301 2:70534969-70534991 ATCCTTATTCTGCTACTTGCTGG + Intronic
933765947 2:85709929-85709951 AGCCCAGCTCCGCTACTTACGGG - Intergenic
935282621 2:101532311-101532333 ATCCTGGTTCTGCCATTTACAGG - Intergenic
935366125 2:102292738-102292760 GTCCTAGCTCTACTACTTACTGG - Intergenic
935495804 2:103780242-103780264 ATCCTAATTCTGTCACTTACTGG - Intergenic
940733485 2:157421544-157421566 AATCTACTTCTGCTATTTACTGG - Intronic
940965744 2:159835645-159835667 AATGTACTTCTGCTCCTTACAGG - Exonic
941135446 2:161711778-161711800 ATCTTAGCTATGCTACTTACTGG + Intronic
941746550 2:169092932-169092954 AATCTAGCTCTTCCACTTACTGG - Intronic
942869913 2:180722173-180722195 AACTCAGTTCTGCTAGTTAGAGG - Intergenic
945302009 2:208223298-208223320 ACCTCTGTTCTGCTACTTACTGG + Intergenic
945653016 2:212588412-212588434 ATCCTGGTTCTGGTACCTACTGG + Intergenic
946649844 2:221880317-221880339 ATCCTGGCTCTGCTACTCACTGG + Intergenic
1168957594 20:1845438-1845460 AATCTAGGTCTGCCACTTACTGG + Intergenic
1171011869 20:21513391-21513413 AGCCAAGTTTTGCTACTTACGGG + Exonic
1172373163 20:34412028-34412050 ATTACAGTTCTGCTACTTACTGG + Intronic
1173011956 20:39191001-39191023 ATCCCAGCTCTGCCACTTACAGG - Intergenic
1174457030 20:50656267-50656289 ATCCTAGCTCTGCCACTTGCTGG + Intronic
1174570309 20:51496714-51496736 ATCCTGGTTCTGCCACTTATTGG - Intronic
1182779859 22:32858890-32858912 AGTCTAATTCTGCTACTTACTGG + Intronic
1183625957 22:39001891-39001913 ATCCTGCTTCTGCCACTTACTGG + Intergenic
1183737674 22:39652943-39652965 ATCCTGGTTCTGCTATTGACTGG + Intronic
949829592 3:8199627-8199649 ATCCCAGTTCTACTACTTACTGG + Intergenic
950160939 3:10760753-10760775 AACATAGTTCTGCCACTCGCTGG + Intergenic
950657824 3:14447984-14448006 ATCCCAGTTCTGCCACTTACTGG + Intronic
950999997 3:17547034-17547056 CACCTAGATCTGCTACTGATTGG - Intronic
951397471 3:22187004-22187026 AACCCAGCTCTGCGACTTGCTGG - Intronic
951985042 3:28610011-28610033 AACCTAAGACTGCTACTTATTGG - Intergenic
952600867 3:35080781-35080803 AACTGAGATATGCTACTTACTGG + Intergenic
952818410 3:37465458-37465480 ATCCCAGCTCTGCCACTTACTGG + Intronic
954702421 3:52457194-52457216 AACCTGGTTCTGCCATTTCCTGG - Intronic
956051810 3:65256126-65256148 TTCCTAGTTCTACCACTTACTGG + Intergenic
956923482 3:73956201-73956223 ATTCTAGTTCTGCCACTAACTGG + Intergenic
957951641 3:87135314-87135336 ATCCTGATTCTGCCACTTACCGG - Intergenic
959177868 3:102939509-102939531 AGCCTAGTTCTGTTACTTTAAGG - Intergenic
960329673 3:116343354-116343376 ACCCTAGATCTGCCACTGACTGG + Intronic
960571085 3:119185974-119185996 AGCCTAGCTCTGCCACTTACTGG + Intronic
961122170 3:124382064-124382086 ATCCTGGTTCTGCCACTTACTGG + Intronic
961772443 3:129259946-129259968 ATCTTGGTTCTGCCACTTACTGG + Intronic
962041023 3:131707575-131707597 ACCCCAGCTCTGCTAATTACTGG - Intronic
964047396 3:152345773-152345795 ACCCTAGTTCTGCCGTTTACTGG + Intronic
964557924 3:157961252-157961274 ATCCTAGTTCTGATTCTGACAGG + Intergenic
965835601 3:172848493-172848515 ATCCCAGCTCTGCTATTTACTGG + Intergenic
966054641 3:175670173-175670195 ATCCTAGTTTTGCTACTTTCTGG - Intronic
966363265 3:179152489-179152511 AACCTAGTTCTTAAACTTACTGG + Intronic
966784783 3:183613395-183613417 ATCCCAGTTCTGCTACTTACTGG - Intergenic
967069949 3:185953791-185953813 CACCAAGTTCTGCCACCTACAGG - Intergenic
967787790 3:193515888-193515910 AGACTAGCTCTGCCACTTACTGG + Intronic
967823574 3:193860737-193860759 AACCTAGTTATTCCACTTCCGGG + Intergenic
969847980 4:9934609-9934631 AATCCAGCTCTGCTACTAACTGG - Intronic
970394369 4:15651251-15651273 TTACTAGTTCTGCTACTTATTGG - Intronic
971214583 4:24651355-24651377 AACAAATTTCTGCTACTTCCTGG + Intergenic
973019950 4:45190567-45190589 ATCCTAGTTCTTCTACTGCCTGG - Intergenic
976315670 4:83656347-83656369 AACCTAGCACTGCTACTTATTGG - Intergenic
977565642 4:98577737-98577759 AATCCAGTTCTGCTATTCACTGG + Intronic
977604503 4:98968815-98968837 ATCCTAGCTCTGCTGCTTACTGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978742230 4:112149540-112149562 GACCTAGTTCTTCTACTTCTAGG - Intronic
979672455 4:123374136-123374158 ATCCCAGTTTTGATACTTACTGG + Intergenic
981041557 4:140227640-140227662 ATCCTTGTTCTGCAACTTACTGG + Intergenic
981686402 4:147459418-147459440 ACCCTAGTAATGCAACTTACAGG + Intergenic
981943864 4:150317763-150317785 ATCCTACTTCTGCCACTGACTGG + Intronic
982080894 4:151788590-151788612 GACCAAGTTCTCCTGCTTACTGG + Intergenic
984281849 4:177679813-177679835 ATCTTAGCTCTGCTACTTTCTGG - Intergenic
984832872 4:183991916-183991938 AGCCCAGTTCTGCTCCTCACTGG - Intronic
984913705 4:184700486-184700508 ACCCAAGCTCTGCCACTTACTGG - Intronic
986698377 5:10378398-10378420 ATCCTGGTTCTGCCACTAACTGG - Intronic
987422543 5:17737526-17737548 CTCCGAGTTGTGCTACTTACCGG - Intergenic
990305584 5:54491639-54491661 ACCCTAGTTCTGTCTCTTACTGG - Intergenic
990942986 5:61222235-61222257 ATCCTTGTTCTGCTACCTGCTGG + Intergenic
991257904 5:64635608-64635630 AAACTGGTTATGCTGCTTACTGG - Intergenic
991411021 5:66345909-66345931 ATCCCAGCTCTGCCACTTACAGG + Intergenic
994680006 5:102874939-102874961 ATCCTTGTTCTCCTATTTACCGG - Intronic
995990759 5:118236314-118236336 AACCTCAAGCTGCTACTTACTGG + Intergenic
996387478 5:122924818-122924840 CACCCAGATCTGCTACTTCCTGG - Intronic
997059745 5:130487548-130487570 AGCCTAGTTCTGCTTTTCACTGG - Intergenic
998468699 5:142366264-142366286 AAATCAGTTCTGCTACTTCCTGG + Intergenic
998795359 5:145812425-145812447 AATCTGGTGCTGCCACTTACTGG + Intronic
998841013 5:146253814-146253836 ATCCTAGTTGTGCTGCTTATTGG + Intronic
999015794 5:148103463-148103485 AAACTAATTCTGCCACTTAGTGG + Intronic
1000286471 5:159830780-159830802 AACCTAATTCTGCCATTAACTGG + Intergenic
1001082864 5:168679830-168679852 ATCCTAGCTCTGCCACTTACTGG + Intronic
1001593499 5:172882530-172882552 ATCCTAGCTCTGCCACTCACTGG + Intronic
1001712190 5:173787826-173787848 ATTTTAGCTCTGCTACTTACTGG + Intergenic
1002027268 5:176404119-176404141 ATCCTGGTTCTGCCACTTCCTGG - Intronic
1002154970 5:177270313-177270335 AAACTAGTTCTGCTTATAACAGG - Intronic
1004174086 6:13323862-13323884 ATCCTAGCTCTGCCACTTACAGG + Intronic
1004538773 6:16528766-16528788 AACCTAGCTTTGTCACTTACTGG - Intronic
1004612336 6:17255300-17255322 ATCCTAGCTCTGCCTCTTACTGG - Intergenic
1004755969 6:18610549-18610571 AACCTGGTTCTCATACTTACTGG + Intergenic
1004873643 6:19933414-19933436 AACCTGGTTCTGCTGTTGACTGG + Intergenic
1005898569 6:30198282-30198304 AACCCAGGTCTGCTACTGCCAGG + Intronic
1006838614 6:37014312-37014334 ATCCCAGTTCTGCTACTCTCTGG - Intronic
1007146476 6:39638965-39638987 ACTCTAGATCAGCTACTTACAGG + Intronic
1007444788 6:41896353-41896375 TACCTAGTTCTCCTGTTTACAGG - Intergenic
1010046292 6:71447766-71447788 ATTCTGGTTCTGCTACTCACCGG + Intergenic
1010066887 6:71692783-71692805 AACCTAGTTATGTTATTTTCAGG + Intergenic
1010778539 6:79915858-79915880 AATATATTTCTGCTACTAACAGG + Exonic
1011902747 6:92320668-92320690 AAGCTGTTTCTGCTACTTAAAGG - Intergenic
1015509246 6:134021679-134021701 ATCCCAGCTCTTCTACTTACTGG - Intronic
1016269746 6:142274778-142274800 GACTTAGATCTGCCACTTACAGG - Intergenic
1016375542 6:143416907-143416929 ATTCTGGTTCTGCTACTCACTGG + Intergenic
1016708491 6:147142104-147142126 ACCTTAGTTCTGCAACTTAATGG - Intergenic
1017381246 6:153833359-153833381 AACCTAGTTCTTTTGGTTACAGG + Intergenic
1018617505 6:165702087-165702109 AACATGGTTTTGCCACTTACGGG - Intronic
1018668388 6:166160529-166160551 ATCCTGGTTCTGCCACTTACTGG - Intronic
1019790051 7:3005895-3005917 AACCTGGCTCTACCACTTACTGG + Intronic
1021846844 7:24771541-24771563 ATCCTGGTTCTGCCACTTACTGG + Intergenic
1021895559 7:25231956-25231978 ACCCTGGTTCTGACACTTACTGG - Intergenic
1022324645 7:29320163-29320185 AATCTAGTTCTGCCACTTTCTGG - Intronic
1022412950 7:30153538-30153560 ATCCTGGCTCTGCCACTTACTGG + Intronic
1022763323 7:33381002-33381024 CACCGAGTTCTGCAACTCACAGG + Intronic
1024486074 7:49921474-49921496 ATCCCAGTTCTACCACTTACTGG + Exonic
1024499701 7:50091894-50091916 ATCCTAATTCTGCCACTTACTGG + Intronic
1025749077 7:64275674-64275696 ATCCTGGTTCTGCCACTTATGGG + Intergenic
1025794912 7:64730387-64730409 ATCCCAGTTCTGCCACTTATGGG + Intergenic
1028683511 7:93566455-93566477 CTCCTAATTCTGTTACTTACAGG + Intronic
1028850980 7:95537165-95537187 AATCTTATTCTGCTACTTATTGG + Intronic
1030275325 7:107714726-107714748 GTCCTCATTCTGCTACTTACTGG + Intronic
1030511388 7:110486705-110486727 AGTCTAGTTCTGCCACTTACTGG + Intergenic
1031200941 7:118684523-118684545 AACCAAGTTCTGCTAGAAACTGG + Intergenic
1031857387 7:126938890-126938912 ATCCTAGTTCTCCCAATTACAGG + Intronic
1032102072 7:128988621-128988643 AACCTAGATTTGCTGCTTTCTGG + Intronic
1032595342 7:133234073-133234095 ATCCTTTTTCTGCCACTTACTGG - Intergenic
1033637614 7:143226557-143226579 AACTTTGTTTTGCTGCTTACAGG - Intergenic
1036293166 8:7513404-7513426 AATCTATTTCTGCAACTAACTGG - Intergenic
1036329391 8:7807596-7807618 AATCTATTTCTGCAACTAACTGG + Intergenic
1037895580 8:22651542-22651564 AACCTTGTTCTTCTACCTGCAGG + Intronic
1038494826 8:27993960-27993982 ATACTAGCTCTGCCACTTACTGG - Intergenic
1038793098 8:30686050-30686072 ATCCTAGCTCTGCAACTTACCGG + Intronic
1039518231 8:38150658-38150680 ATCCTAGTTGTGCCTCTTACTGG - Intronic
1043959327 8:86397969-86397991 ATTCCAGTTCTGCTACTTATTGG - Intronic
1044103332 8:88169466-88169488 AACCCAGCTCTGCCACTTAGAGG - Intronic
1044717105 8:95110618-95110640 ATCCCAGCTTTGCTACTTACTGG - Intronic
1047281197 8:123447590-123447612 ATCCTGGCTCTACTACTTACTGG - Intronic
1047722326 8:127652616-127652638 ATCCTGGTTCTGCAATTTACTGG + Intergenic
1047765144 8:127984393-127984415 ATCCTAGCTCTGCCACTTGCTGG - Intergenic
1047795605 8:128252088-128252110 AATCTTGTTCTGCTGCTTTCGGG + Intergenic
1048186644 8:132248037-132248059 ATCCTAGCTCTGCCACTTCCTGG - Intronic
1048335479 8:133499115-133499137 ATCCCAGCTCTGCCACTTACCGG + Exonic
1049346128 8:142139693-142139715 AACCCAGCTCTGTTGCTTACAGG + Intergenic
1050309339 9:4336626-4336648 ACCCTAGTTCTGTCGCTTACTGG - Intronic
1050336765 9:4597132-4597154 ATCCTAGTTCTGCCATTTACAGG - Intronic
1050457969 9:5851710-5851732 TACCTAGTTTTGCAACTTTCAGG - Intergenic
1050606977 9:7312178-7312200 AAGCTACTTCTGCTCATTACTGG + Intergenic
1052742103 9:32403172-32403194 AACCTAGCTCTGCCTCTTACTGG + Intronic
1052843303 9:33312245-33312267 ATCCTGGTTCTGTCACTTACTGG + Intronic
1053372588 9:37575567-37575589 ATCACAGTTCTGCCACTTACTGG - Intronic
1055053388 9:72001426-72001448 AACCTAGTGCTGCCACTGATAGG + Intergenic
1055213291 9:73825871-73825893 AATCTAACTCTGCTAATTACAGG - Intergenic
1057772537 9:97981720-97981742 ATCCTAGCTCTGCTTCTTGCTGG + Intergenic
1058106533 9:100978218-100978240 CTTCTAGTTCTGCTTCTTACTGG - Intergenic
1058951550 9:109908424-109908446 ATCCCAGCTCTGCCACTTACTGG + Intronic
1059159599 9:112021484-112021506 ATCCTAGCTCTGCTAGGTACTGG + Intergenic
1059321419 9:113473335-113473357 ACCCCAGCTCTGCCACTTACTGG + Intronic
1059722038 9:116969258-116969280 AACCTGGTTCTATTACTTACTGG + Intronic
1059739219 9:117133372-117133394 ATCCTAGCTCTGCCACTGACTGG - Intronic
1060246219 9:121948669-121948691 AGCCTGGTTCTGCCACTTCCTGG - Intronic
1060269185 9:122128905-122128927 AACCCAGCTCTGCCACTTTCTGG + Intergenic
1060665926 9:125432131-125432153 ATCCTAGTGCTGCCACTTGCTGG - Intergenic
1062275062 9:135726549-135726571 AGCCAAGTTCTGCTACGGACGGG + Intronic
1186830608 X:13386481-13386503 GTCCTGGTTCTGCTACTAACTGG - Intergenic
1186865979 X:13721231-13721253 GGTCTAGCTCTGCTACTTACTGG + Intronic
1187912610 X:24124831-24124853 AACCCAGATCTGCGACTTCCTGG + Intergenic
1188184552 X:27097904-27097926 ATCCAAGCTCTGCTACCTACTGG - Intergenic
1188585753 X:31772701-31772723 ATCCTTGTTCTGCTACTTACTGG + Intronic
1189130418 X:38492299-38492321 AACTTGGTTCTGCCACTTAACGG + Intronic
1189899618 X:45692699-45692721 AACCTGGTCCTGCTTCTTAGAGG - Intergenic
1191678148 X:63813302-63813324 ATCCCAGATCTGCCACTTACTGG + Intergenic
1192208758 X:69113399-69113421 AACCTAGTTCTTCTACCTTCTGG + Intergenic
1193722814 X:85006382-85006404 AACCTAGTTCTTCCACTTAGTGG - Intronic
1195792229 X:108600759-108600781 TCCCTAGTTCTTCAACTTACAGG - Intronic
1195829718 X:109043323-109043345 AACCCATTTCTGCTATTTACTGG + Intergenic
1196188181 X:112766680-112766702 ATCCTAGCTCAGCTACTTACAGG - Intergenic
1196282772 X:113842612-113842634 ATCCCAGCTCTGCCACTTACTGG + Intergenic
1196406118 X:115364465-115364487 AAGTTAGCTCTGCCACTTACTGG - Intergenic
1197190886 X:123646876-123646898 AACCTAGTTTTTCCAGTTACAGG - Intronic
1197882257 X:131179131-131179153 AACCTAGTTCTCCTATTCATTGG + Intergenic
1198373584 X:136015442-136015464 ATCCTGGTTCTACTACTTGCTGG + Intronic
1199552300 X:149073599-149073621 AACATAGTTATGCTACAGACAGG + Intergenic
1199905515 X:152225315-152225337 AACATAATTCTGCTGCTCACAGG + Intronic