ID: 1115632613

View in Genome Browser
Species Human (GRCh38)
Location 14:35260406-35260428
Sequence TCCTTATGTTGAGGGAGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 14, 2: 29, 3: 38, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115632613 Original CRISPR TCCTTATGTTGAGGGAGTAC TGG (reversed) Intronic
900781190 1:4618050-4618072 TCCTTATCTTGAGTGGGTGCTGG + Intergenic
901064868 1:6489864-6489886 TCCTCAAGTTGAGGGAGCTCGGG - Intronic
901153981 1:7123331-7123353 TCCTTATGGAGAGGGAGAATTGG - Intronic
902426619 1:16328821-16328843 TCCTTACTTTGTGGCAGTACTGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
904311054 1:29629869-29629891 TTCTTCTTTTGAGGGAGGACAGG + Intergenic
906306331 1:44722293-44722315 TCCTTAAGTGCAGGGATTACAGG - Intronic
906876613 1:49545894-49545916 TCCATAAGTTATGGGAGTACAGG + Intronic
907483693 1:54762031-54762053 ACCTAATGTTGAGGCAGTAAGGG - Intronic
908067909 1:60427391-60427413 ACCTTAGTCTGAGGGAGTACAGG + Intergenic
909742376 1:79045833-79045855 TCCTTATGATACGGGAGTGCTGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
911728380 1:101266348-101266370 TCCTGATGTTCTGGGATTACAGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916489028 1:165285230-165285252 TCCTTAGGTGGAGAGAGTTCTGG + Intronic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
919437559 1:197580860-197580882 TCCTTATGTTGAGACAGTACAGG - Intronic
920623850 1:207576990-207577012 TCCTAATGTGCTGGGAGTACAGG - Intronic
1067538751 10:47136442-47136464 TGCTGATGTGGAGGGAGGACAGG - Intergenic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1072495307 10:95951408-95951430 TCCTTATATGGTGGGATTACAGG + Intronic
1073390776 10:103174572-103174594 TTCTTTTTTTGAGGGAGTGCTGG - Intronic
1074561367 10:114538473-114538495 TTCTTATGTGGTGGGTGTACAGG + Intronic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1080244421 11:30163485-30163507 TTCTTATGGTATGGGAGTACAGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1090624555 11:128594642-128594664 TGGCTATGTTGAGGGAGTAAGGG - Intergenic
1091800328 12:3320988-3321010 TCATCTTGTTGAGGGAGGACAGG - Intergenic
1094497023 12:30994939-30994961 TCCTTATGGAGATGGAGAACTGG - Exonic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1099192769 12:79577373-79577395 TTCTTATGTTGAGGCAGTTGAGG - Intronic
1100412672 12:94337357-94337379 TCATTTTGTTGAAGCAGTACTGG + Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1105455717 13:20539588-20539610 TCCTAAAGTTGTGGGATTACTGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109270018 13:60245510-60245532 TCCCTATGTGAAGGGAGTAGTGG + Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1111613498 13:90635968-90635990 TCCTTCTGTTGAAGGAGTCTAGG + Intergenic
1112797492 13:103072150-103072172 TCCTAATGTTCTGGGATTACAGG + Intergenic
1114325347 14:21583295-21583317 TCCCAATGTGGAGGGATTACAGG + Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1117361017 14:54974161-54974183 TCCTTATGTACTGGGATTACAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120531345 14:85635388-85635410 TCCTTGTTTTGAGGGAGAAGTGG - Exonic
1122299262 14:100722814-100722836 TCCCTGTGTTGAGGGCTTACAGG - Intergenic
1122566079 14:102657305-102657327 TCCTCATGTTCAAGGAGTAATGG + Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1126246402 15:46511200-46511222 TCCTAAAGTTTTGGGAGTACAGG - Intergenic
1127963836 15:63909298-63909320 TCCTTTTGTTTAGGAAGCACTGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129124678 15:73428663-73428685 TCCCAAAGTTGAGGGATTACAGG + Intergenic
1129145281 15:73641488-73641510 TCCTTGTGTGGAGGGAGAACTGG - Intergenic
1129762294 15:78136878-78136900 TCCTGTTGTTGAGGGAGGAGGGG + Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1133943720 16:10331317-10331339 TCCTAAAGTTCTGGGAGTACAGG - Intronic
1136233491 16:28901371-28901393 TCCTTAAGTTCTGGGATTACAGG - Intronic
1137597654 16:49735496-49735518 TCGTTATGATGAGGGAGTCAAGG - Intronic
1140127209 16:72128013-72128035 TGCTTATGATGAGGGAGAAAGGG + Intronic
1140276082 16:73509952-73509974 TCCTAAAGTTCTGGGAGTACAGG + Intergenic
1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG + Intergenic
1144067119 17:11634526-11634548 ATCTTCTGTTGAGGAAGTACAGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146618488 17:34376236-34376258 TCCTTAGGTTGGGGGAGTCAGGG - Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152928477 17:83098644-83098666 TCCTCATGTGGAGGGAGTCGAGG - Intergenic
1154267517 18:12891948-12891970 TCATTATATTGAGGGAGCAAGGG - Intronic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1156636017 18:39030356-39030378 TCATTTTCTTGGGGGAGTACAGG + Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1159682164 18:71368311-71368333 TACTTATGTGTAGGGAGGACTGG + Intergenic
1160315027 18:77835207-77835229 TCCATATGCTGAGAGAGCACAGG - Intergenic
1163353847 19:16796876-16796898 TCCTTAAGATGAGTGATTACTGG + Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1165944129 19:39431346-39431368 TCCTCATGTTGAGGGGCCACAGG + Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
927796451 2:26053235-26053257 TCATTATTTTGAAGGAGGACTGG - Intronic
929607254 2:43242986-43243008 TCCTAATGTGAAGGGAGCACTGG + Intronic
929960192 2:46490539-46490561 CCCTCCTGTTGATGGAGTACAGG - Intergenic
930929021 2:56858589-56858611 TCCTTAGTATGTGGGAGTACAGG + Intergenic
930929037 2:56858723-56858745 TCCTAATGTGCAGGGATTACAGG + Intergenic
932033513 2:68215389-68215411 TCCTTATGGACAGGGAATACAGG - Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
937110653 2:119364818-119364840 TCCTAACGTGGTGGGAGTACAGG - Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938754018 2:134363269-134363291 TCCTACAGCTGAGGGAGTACAGG + Intronic
942284209 2:174397591-174397613 TCCTTCCTTTGAGGAAGTACTGG + Intronic
943921795 2:193716288-193716310 TTCTTATGTTCAAGGAATACTGG - Intergenic
944360516 2:198850183-198850205 TCCATATGTTATTGGAGTACAGG - Intergenic
944540290 2:200747765-200747787 TCATTATGTGGAGGGAGGAGGGG + Intergenic
945683785 2:212944628-212944650 TCCATTTGTTCAGTGAGTACCGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1170868103 20:20178191-20178213 TCCTTTTGTTTAGTGACTACAGG + Intronic
1172162769 20:32879944-32879966 TCCTCATGCTTAGGGAGTCCAGG - Intronic
1173388976 20:42614589-42614611 TCCTGAAGTTGAGGGAATAGAGG - Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179806747 21:43843655-43843677 TCCTAAAGTGGAGGGATTACAGG + Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181908880 22:26222053-26222075 CGATTATGTGGAGGGAGTACCGG - Intronic
950736501 3:15013130-15013152 GCCTTAGGTTGAGAGAATACAGG - Intronic
952065336 3:29562778-29562800 TGCTTATGATGAGTGAGTATGGG - Intronic
952107110 3:30083634-30083656 TCCTTCTGGTGAGGCAGTGCTGG - Intergenic
952631655 3:35477193-35477215 TCCTTATAGTGAGTGAGTCCTGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
963460700 3:145611290-145611312 TCCTGATGTTGAGGGCTTTCTGG + Intergenic
964021305 3:152015347-152015369 TTCTTATTTTGAGGTAATACAGG + Intergenic
964690554 3:159444879-159444901 ACCTGATGTTGAGGGAGTGAAGG + Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966094347 3:176180732-176180754 TCCATATGTTATTGGAGTACAGG + Intergenic
966317457 3:178664101-178664123 TCCTGATGGTTAGGGAGAACAGG + Intronic
967305393 3:188054008-188054030 TCCCTATGTGGACGGAGAACAGG - Intergenic
969833980 4:9823910-9823932 TGCTTATGTTGGGGGAGTGAAGG + Intronic
970150226 4:13081803-13081825 CCTTTATGTTGAGGAAGGACCGG - Intergenic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972566523 4:40274260-40274282 TGCTTAAGTTAATGGAGTACAGG - Intergenic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
976073885 4:81274308-81274330 TGCTTATATTCAGGGAGTACAGG - Intergenic
977210163 4:94208937-94208959 TCAATATTTTGAGGGAATACTGG - Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
981405943 4:144369250-144369272 TCCTGATGGTCAGGGAGTAGGGG + Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
984552467 4:181177039-181177061 TCCTTAAGTTCTGGGATTACCGG + Intergenic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
987994881 5:25263805-25263827 TCCTGAGGCTGAGGGATTACAGG + Intergenic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
991938967 5:71831764-71831786 TCTTTATGTTGAAGGAGATCAGG + Intergenic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
994519562 5:100815243-100815265 TCCTTATGTGGATGGATTATAGG - Intronic
997761413 5:136451771-136451793 TCCATAAGTTGTGGGGGTACAGG - Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1005337316 6:24810088-24810110 TCCTAATGTGGTGGGATTACAGG + Intronic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1010775330 6:79878648-79878670 GCCTCAGGTTGAGGGAGGACTGG - Intergenic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1012820296 6:104078416-104078438 TCCCTATGTGCTGGGAGTACAGG + Intergenic
1014143000 6:117965543-117965565 TCCTTTTGGGGAGGGAGGACGGG - Intronic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1016739137 6:147509372-147509394 TCCTTACCTTGCGGGAGTACGGG - Exonic
1017091954 6:150767129-150767151 TCTTTATTTTGAGGGAGTGTAGG + Intronic
1021780896 7:24104353-24104375 TAATTATAGTGAGGGAGTACAGG - Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023906333 7:44524494-44524516 TTCTGATGTTGTGGGATTACAGG - Intronic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1027736819 7:81942827-81942849 TCCTTTCCTTGAGGGACTACTGG - Intergenic
1030978425 7:116156085-116156107 TCCTGATGCTGAAGGAGTCCTGG + Intronic
1031741302 7:125434908-125434930 TCCTCATGTTTAGGGAGGAAGGG + Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033608037 7:142941699-142941721 TGAGTCTGTTGAGGGAGTACAGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1037476756 8:19265248-19265270 TCCTTATCTGCAGGGAATACGGG - Intergenic
1038967862 8:32595445-32595467 TCCGTAAGTTGGGGGATTACAGG + Intronic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039805901 8:40997934-40997956 ACCTTATGTGGAGGGAGGAAGGG - Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040659693 8:49556953-49556975 TCCTTAAGTTCTGGGATTACAGG - Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1045158545 8:99508874-99508896 GCCTTATGTTAAGGGAGTTAAGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055093364 9:72385466-72385488 TTAGTATGTTGAGGGAGTTCAGG - Intergenic
1055438871 9:76319640-76319662 TCCTTTTCTTGAGGGAGTCAGGG + Intronic
1055462634 9:76533147-76533169 TTCTTATGTTAAAGGAGTAACGG - Intergenic
1056501602 9:87215154-87215176 TCTTTATTTGGTGGGAGTACTGG - Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1056798017 9:89672269-89672291 TCCTTAAGTTCTGGGATTACAGG - Intergenic
1057652184 9:96929133-96929155 GGCTGATGTTGAGGGAGCACTGG + Intronic
1059989681 9:119853525-119853547 TCTTTAGCTTGAGGGAGGACAGG + Intergenic
1060028511 9:120193411-120193433 TCCTAAAGTTCTGGGAGTACAGG - Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1062553539 9:137102165-137102187 TCCTGCTGTTGCAGGAGTACAGG + Intronic
1203785247 EBV:123978-124000 TTCTTCTGTTGAGGGGGTATGGG + Intergenic
1185820763 X:3201593-3201615 TCCTTTTGTTGAAGAAGCACAGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187030018 X:15476832-15476854 TGCTGATGTTGAGGGAAAACAGG + Intronic
1189662238 X:43312598-43312620 TTCTTTTGTTGAGGGACAACAGG - Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194926169 X:99827409-99827431 TCCTTAAGTTGTTGGAGTACAGG + Intergenic
1195529493 X:105936564-105936586 TCCTTATGCTCATGGAGCACAGG + Intronic
1196859117 X:120011189-120011211 TCCTAATGAAGAGGGAGTAGAGG - Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1197787740 X:130216738-130216760 TCCCAAAGTTCAGGGAGTACAGG - Intronic
1198101097 X:133422395-133422417 GCATTATCTTGAGTGAGTACAGG + Intergenic
1198229240 X:134673736-134673758 TCCATCTGTTGAGGGAGGAAAGG + Intronic
1198848986 X:140944963-140944985 TCCTTTTTTTGAGGAACTACTGG - Intergenic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1199794676 X:151182896-151182918 TACTTATGGGGAGGGTGTACAGG + Intergenic
1200087976 X:153619407-153619429 TCCTAAAGTGGAGGGATTACAGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic