ID: 1115635347

View in Genome Browser
Species Human (GRCh38)
Location 14:35285692-35285714
Sequence CCTCCCTTTCCCCACCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 1, 2: 6, 3: 64, 4: 539}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115635342_1115635347 24 Left 1115635342 14:35285645-35285667 CCTCTCTGTTCTTGACTCACTTT 0: 1
1: 0
2: 4
3: 34
4: 413
Right 1115635347 14:35285692-35285714 CCTCCCTTTCCCCACCTTCAGGG 0: 1
1: 1
2: 6
3: 64
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115635347 Original CRISPR CCTCCCTTTCCCCACCTTCA GGG Intronic
900098796 1:952257-952279 CCACCCTTCCCCCACCTGCAAGG + Intronic
900394202 1:2446470-2446492 CCTCCCTCCCCCCAGCTGCAGGG + Intronic
900584110 1:3424306-3424328 CCTCCCTTTCCCTGCCTGCAGGG + Intronic
901321038 1:8339944-8339966 CCTCCCATTCCCCACATCCCTGG - Intronic
901474636 1:9481122-9481144 CCTCCCTTTCCACACTGTCCTGG + Intergenic
901724830 1:11232915-11232937 TCTTCCTTTCTCCACCATCATGG + Intronic
902207188 1:14877490-14877512 CCTCCCCTTCCCCAACTCCTGGG - Intronic
902692881 1:18121171-18121193 CTTCCCTTCCCCCATCTGCAAGG - Intronic
902924919 1:19689776-19689798 GCTCCCTTTCACCCCATTCAGGG + Intronic
902994391 1:20212464-20212486 CGTTCCCTTCTCCACCTTCAGGG + Intergenic
903231882 1:21927181-21927203 CCTCCCCTTCCCCACCGACTGGG + Intronic
903410763 1:23141199-23141221 CCTCCTTTCCCCCACCTTCCAGG - Intronic
903498782 1:23790706-23790728 CCTCAGTTTCCCCATCTTCAAGG + Intergenic
904535975 1:31199623-31199645 CCTCCCTCTCCCCATCTCCGGGG + Intronic
905017292 1:34786414-34786436 CTTACCTTTCCCTACCTTCAGGG - Intronic
905403019 1:37716778-37716800 CCTTCCCTTTCCCACCTGCAAGG + Exonic
905548300 1:38817248-38817270 CCTCAGTGTCCCCACCTCCAAGG + Intergenic
906035138 1:42746146-42746168 CCTCCCTCTGCTCACCTTCTGGG - Intergenic
906200916 1:43959764-43959786 CCTGCCTTTCCTCACCTCCCAGG + Intronic
906661503 1:47586028-47586050 CCTCCTTGTCCCCTCCTTCAGGG - Intergenic
906668260 1:47636935-47636957 CCTACCTTACCCCAGCCTCAGGG - Intergenic
906722927 1:48022465-48022487 ACTCCCTACCCCCAACTTCAAGG - Intergenic
907339952 1:53727713-53727735 CCTCCCTCTCCCCTCCCTCTGGG - Intronic
907355785 1:53872753-53872775 TGTTCCTTTTCCCACCTTCAGGG - Intronic
907951734 1:59189845-59189867 CCTACCCTTCCCCACCTCCCTGG + Intergenic
908403383 1:63791262-63791284 GCTCCCTCTCCACACCTTCCAGG - Intronic
908404882 1:63805047-63805069 CCTCCCTTTCAGCGCATTCAGGG - Intronic
908478136 1:64508920-64508942 CCTGCCATTCCCCACCCCCAGGG + Intronic
908603328 1:65765069-65765091 TCTCTCTTTCCCCATCTCCATGG + Intergenic
908633251 1:66133815-66133837 CCTCCTACTCCCCACCTTCCAGG - Intronic
909075827 1:71048848-71048870 CCTCAGTTACCCCACCTTTAAGG - Intergenic
909129038 1:71712004-71712026 CCTCCCCTTCTCCACCCTCTTGG - Intronic
910116912 1:83741591-83741613 GCTCCCCTCCCCCACCTTGATGG + Intergenic
912806432 1:112760298-112760320 CCTCCCCTTCCCCACCTCCCAGG + Intergenic
912942349 1:114056355-114056377 TCTCCCTGGCCCCACCTTTATGG - Intergenic
913318971 1:117575680-117575702 CCTCCCCCTTCCCAGCTTCATGG + Intergenic
913534635 1:119759476-119759498 TTTCCCTTTCCTCACCTACATGG + Intronic
914750815 1:150533894-150533916 CCTCCCTCTCTCCTCCTCCAAGG - Intergenic
914801968 1:150968590-150968612 CCTCAGTTTCCCCAGCTTCCTGG + Intronic
914845397 1:151281290-151281312 CCTCCCTTTCCCCCGCCTCCAGG + Intronic
914957514 1:152177049-152177071 TCTCCCTTCCCCCACCCACAAGG + Intergenic
915105483 1:153532999-153533021 CCTCCCCTCCCCAACCTGCAGGG - Intergenic
915540572 1:156563396-156563418 CATCCTTTTTCCCACCCTCAAGG + Intronic
915552087 1:156641255-156641277 CCTCCTTTCCCCCAGCTCCAGGG - Intergenic
915570719 1:156743824-156743846 CCTCCTTCTCCTCTCCTTCAGGG + Exonic
915691522 1:157695575-157695597 TCACCCTGTCCTCACCTTCAGGG - Exonic
915731159 1:158055488-158055510 CCTCAGTTTCCCCAACCTCATGG + Intronic
915937953 1:160099812-160099834 CCTCCATTCTCCCACCTCCAGGG - Intergenic
916448858 1:164899918-164899940 TCTCCCTTCTCCCACCCTCAAGG - Intergenic
917053347 1:170950058-170950080 CCTCTGTTTCCCCATTTTCAAGG - Intronic
917482181 1:175421879-175421901 CCTTCCTTTCCTTTCCTTCATGG - Intronic
917726926 1:177837069-177837091 TCCCTCTTTCCCCATCTTCAGGG - Intergenic
918794677 1:188877772-188877794 ACTCCCTTTCACCACCATGAGGG - Intergenic
919223215 1:194658808-194658830 CCACTCTTCCCCCAACTTCATGG + Intergenic
919538361 1:198816582-198816604 CTTCCATTTCCCCACCTCCTTGG + Intergenic
919841244 1:201610948-201610970 CCTCCCCTTCGCCACCCCCAGGG - Intergenic
919974474 1:202601892-202601914 CCTCCTTTTCCCCGCCTTGCAGG + Exonic
919978140 1:202626152-202626174 CCTCCCATTACCCACGTACAGGG - Intronic
920095957 1:203486989-203487011 CCTCCCTTATCCCACCCTCGAGG + Exonic
920398976 1:205665394-205665416 CCTCCCTTTCCCCTTCATCCTGG - Intronic
920521235 1:206628446-206628468 GCTCCTTTTCACCATCTTCAGGG - Intergenic
921276870 1:213529301-213529323 CATCCCATTCCCCACCACCATGG - Intergenic
921681889 1:218043521-218043543 CCTTCCTTTCCCCACAGGCAGGG + Intergenic
922171764 1:223161562-223161584 CCTCCCTCTCTCCACCACCAGGG - Intergenic
922775238 1:228211501-228211523 CTTCCCTCTCCCTACCTACAGGG - Intronic
923037126 1:230292124-230292146 CCTCCCTTTCCTCACCTGCTTGG - Intergenic
924427201 1:243962755-243962777 CCTCCCTTGCCCCACCAGGAGGG + Intergenic
924456019 1:244219537-244219559 CCTTCCCTTCCTCACCCTCAGGG - Intergenic
924552505 1:245091545-245091567 CCTCCCCAGCCCCACCTTCGAGG + Intronic
1062854325 10:772228-772250 CCTCCATTTCCCCACCTCCCAGG - Intergenic
1063382798 10:5596883-5596905 ACTCCCTTTGCCCACCTGGATGG - Intergenic
1063754917 10:8996855-8996877 CCTCCCTTCCCCCCTTTTCATGG + Intergenic
1064944202 10:20770240-20770262 CCACCCTGCTCCCACCTTCAAGG - Intergenic
1065500588 10:26377829-26377851 CTTTCTTTTCCCCACATTCATGG + Intergenic
1065581505 10:27176159-27176181 CCTCAGTTTCATCACCTTCATGG + Intronic
1067548588 10:47215975-47215997 CCTCCCTTTCATCTCCTTCTGGG - Intergenic
1068551720 10:58414947-58414969 CCTCCCTTCTCCCTCCTTCTTGG + Intergenic
1069557191 10:69406262-69406284 CCTTATTTGCCCCACCTTCAGGG + Intronic
1069958841 10:72067961-72067983 CCTCCCTCTGCCCACCTTCCAGG + Intronic
1069964378 10:72101981-72102003 CCTCCCTCCCTCCACCCTCAAGG - Intronic
1070456709 10:76624274-76624296 CCAGCCTTTCCTCACCTTCAAGG + Intergenic
1070781328 10:79139092-79139114 ACTCCCTTGCCCCTCCTACAAGG - Intronic
1071579245 10:86755608-86755630 CTTCCATTTCCCCTCATTCATGG - Intergenic
1071875460 10:89838308-89838330 CCTGCCTTTCCCATCTTTCACGG - Intergenic
1072122846 10:92419715-92419737 CCTGCCTTTCCCATCTTTCACGG + Intergenic
1072677612 10:97480031-97480053 CTGCCCTTTCCCCACCTTCCTGG + Intronic
1073290875 10:102412651-102412673 CCTCCCCTTCTCCATCTTCTGGG - Intronic
1074544699 10:114393571-114393593 CCTCCCTGTCCCCAGCCTCCAGG - Intronic
1075258463 10:120943729-120943751 CCTCCCAAGCCCCACCTCCAGGG + Intergenic
1075332090 10:121581170-121581192 CCTCACTCGCCACACCTTCAAGG + Intronic
1075505261 10:123015609-123015631 GCCACCTTTCCCCTCCTTCATGG - Intronic
1076170436 10:128314892-128314914 CCTCCCCTCCCCCACCATTAGGG + Intergenic
1076335834 10:129705967-129705989 CATCCCTGACCCCAGCTTCATGG + Intronic
1076547423 10:131254621-131254643 CCTCTCTTTGCCCACCTTCCTGG - Intronic
1077302136 11:1852285-1852307 CCTCACTGTCCCCAGCTTCTGGG - Intergenic
1078367695 11:10720358-10720380 TCTCCCTTCCCCCACCTCCAAGG - Intergenic
1078565436 11:12410265-12410287 CTGCCCTTTCCTCATCTTCAGGG + Intronic
1078741995 11:14075425-14075447 CCTCCCCCTCCCCACCCACAGGG - Intronic
1078939872 11:15990456-15990478 CATCCCTTGCCCTATCTTCAGGG - Intronic
1079671806 11:23180326-23180348 CCCCACCTTCCCCACCTTGAAGG + Intergenic
1080321925 11:31019994-31020016 TCTCCCTTTCAACCCCTTCATGG + Intronic
1080677133 11:34438741-34438763 CCTTCCTTTCCGCACCCTCCTGG + Intergenic
1082818835 11:57529977-57529999 CCTCCCCACACCCACCTTCAAGG - Intronic
1083152092 11:60798272-60798294 CCTCAGTTTCCCCACATTCATGG + Intronic
1083274902 11:61591352-61591374 CCTCCCCTGCCCCTCATTCATGG + Intergenic
1083572095 11:63766303-63766325 TCTCCCTTTCCCCTTCTTCAGGG - Exonic
1083726389 11:64630722-64630744 GCTCCCCTTCCCCACATGCAAGG + Intronic
1083758874 11:64805197-64805219 CCTCCCTTCCCCCTCGTCCAGGG - Exonic
1084031625 11:66484637-66484659 TCTCCCTTCCCCCAGCTCCAGGG - Intronic
1084166165 11:67375643-67375665 TCTCCCTCTCCCCTCCTTCTTGG - Intronic
1084194491 11:67516692-67516714 CCTTCCTTCCACCACCCTCACGG - Intergenic
1084271424 11:68031224-68031246 CATTCCTTTCCCCAGCTTCAAGG - Intronic
1084683970 11:70682915-70682937 CCTCGGTTTCCTCACCTTCAGGG - Intronic
1084748890 11:71190818-71190840 CCTCACTTTCCCCATCTGGAAGG + Intronic
1084782828 11:71422228-71422250 CCTCCCGTCCTCCACCCTCAAGG - Intergenic
1084904855 11:72337874-72337896 GCTCCCTTTCCTCCCATTCAGGG + Intronic
1086258566 11:84909969-84909991 CCTCATTATCCCCTCCTTCAGGG - Intronic
1086396994 11:86425654-86425676 CCTCCCATCCCCCACCCTCTGGG + Intergenic
1086910469 11:92466067-92466089 CCTCCATTTCCCCATCTGGAAGG - Intronic
1087235451 11:95713008-95713030 GCTCCATTTCCTCATCTTCAAGG + Intergenic
1088329222 11:108633087-108633109 CCTCCCTCTCCCAACTTTCCTGG + Intergenic
1088803822 11:113332690-113332712 TCTCCCCTTCCCCAGCTCCAGGG + Intronic
1088976166 11:114818135-114818157 CATTGCTTTCCCAACCTTCACGG - Intergenic
1089059075 11:115611437-115611459 TCTCCCTCTCTCCACATTCAAGG - Intergenic
1089414800 11:118278838-118278860 CCCCTCTTTCCCCACTTTCCAGG + Intergenic
1089519717 11:119055873-119055895 TCTCCCTTCGCCCACCTTCCTGG + Intronic
1089601560 11:119618613-119618635 CCTCCTATTCCCCAACTTCTAGG + Intergenic
1089614329 11:119686777-119686799 CCCTCCTCTTCCCACCTTCATGG + Intronic
1089700872 11:120243021-120243043 CCCCCCTTTCCCAACCTTGGTGG - Intronic
1089715158 11:120352625-120352647 CACCCCTTTCCCCACCCACACGG - Intronic
1089812812 11:121145580-121145602 CTTCCCTTGCCCCAGCTTCAGGG - Exonic
1091176431 11:133562562-133562584 TCCCCCTACCCCCACCTTCAGGG + Intergenic
1091398633 12:169712-169734 CCAACCTTACCCCACCTGCAGGG + Intronic
1091788664 12:3258401-3258423 CCTCTCTTTCCCCATCTCAAAGG - Intronic
1091993773 12:4977054-4977076 TCTCCCTTCCCCAGCCTTCAGGG - Intergenic
1092182055 12:6452644-6452666 CTTCCCCTCCCCCGCCTTCAAGG - Intronic
1092855930 12:12673741-12673763 CCTACCTTTGCCCACCTTTCCGG - Intronic
1094839318 12:34336386-34336408 CCCCCCTTTCCCCACATGCATGG + Intergenic
1095096484 12:38152094-38152116 CATCCTTTTCCCTTCCTTCAGGG - Intergenic
1095296025 12:40528467-40528489 CTTTCCTTTCCCCTGCTTCAAGG + Intronic
1095297440 12:40542975-40542997 TCTTCCTTTCCCCTGCTTCAGGG + Intronic
1095341565 12:41095442-41095464 CAACCCTTTCCCCACATTCAAGG + Intergenic
1095473175 12:42558327-42558349 CCTCCCTTTTACACCCTTCATGG - Intronic
1095507056 12:42909076-42909098 CCTACCTCACCCCACCTTCATGG - Intergenic
1096104118 12:48986728-48986750 CCCCCCTTACCCCACCTTGTCGG + Intergenic
1096197302 12:49656928-49656950 CTCCCCCTTCCCCACCATCAAGG - Intronic
1096529523 12:52234146-52234168 CCTCCCCTCCCCCACCTGCCTGG + Intronic
1097187057 12:57201707-57201729 CCTCACTCTCCCCACCCTCCCGG + Intronic
1097539123 12:60914111-60914133 CCACACCTGCCCCACCTTCAGGG + Intergenic
1097913688 12:64997648-64997670 CCTCAGTTTCCTCACCTTGAAGG - Intergenic
1097999669 12:65926425-65926447 CCTCCCTCTCCCCACCTCCGAGG - Intronic
1098008198 12:66021322-66021344 TCTCCCTTTCTCCCTCTTCAGGG + Intergenic
1098163458 12:67669785-67669807 TCTCCATCTCCCCACATTCACGG - Intergenic
1099037609 12:77608905-77608927 CCTCAGTTTCCCCATTTTCAAGG + Intergenic
1099289772 12:80762114-80762136 CCACCCTGCCCCCACATTCAGGG - Intergenic
1099344702 12:81483520-81483542 CCCCACTTGCCCCACCTCCAAGG - Intronic
1099904853 12:88760198-88760220 CTTCCCCTTCCCCACCTGCTGGG - Intergenic
1100673723 12:96844354-96844376 CACCCCTTTCTTCACCTTCATGG - Intronic
1102044697 12:109822484-109822506 CCACCCCCTCCCCACCTTCCAGG + Intronic
1102681528 12:114693512-114693534 CCACCCTTTCCCCACTTCCTGGG + Intergenic
1103713975 12:122932404-122932426 CCGCCCTTTCCACAGCTGCAGGG - Intronic
1103764818 12:123272125-123272147 CATCCCTGCCCCCACCATCAAGG - Exonic
1103906096 12:124327895-124327917 CCTCCCCTACCCCACCTCCCTGG - Intronic
1104427600 12:128690940-128690962 CCTCTCTTTCCCCAGCTTCCGGG - Intronic
1104671275 12:130682204-130682226 CCTCCCTTCCCCCACTGCCAAGG + Intronic
1106192246 13:27463843-27463865 CTGGCCTTTCCCCACCTGCAGGG + Intergenic
1106319585 13:28625062-28625084 CCTCCCTTTCTCCTTCTTCCAGG - Intergenic
1106808878 13:33339538-33339560 CCACCCCTTTCCCACCTTTATGG + Intronic
1107549427 13:41461084-41461106 CCTTCCTGTTCCCACTTTCAGGG + Intronic
1108689931 13:52850881-52850903 ACCCACTTTCCCCACCTTCCGGG - Intergenic
1108745110 13:53385561-53385583 CCTCTTTTTTCCCACCTTCTTGG - Intergenic
1113535988 13:111066760-111066782 CCTCCCTTCCCGCGCCTGCAAGG - Intergenic
1113536176 13:111067675-111067697 CCTCCCTTTCCCCGCCCTGGAGG - Intergenic
1114567717 14:23644812-23644834 CTTCCCTTTGCCCAGTTTCATGG + Exonic
1115635347 14:35285692-35285714 CCTCCCTTTCCCCACCTTCAGGG + Intronic
1115827032 14:37289921-37289943 CACCCCTTTCCTCACCTACAGGG - Intronic
1117036154 14:51731941-51731963 CCTCCCATTCCCCACCTCCCAGG - Intergenic
1117046868 14:51821742-51821764 CCACCCTCTCCCCACCTCCTGGG - Intergenic
1117814560 14:59583467-59583489 CCTCCCTTTTCCCACCTTCAAGG - Intergenic
1118174615 14:63425498-63425520 CCCCCTTTTCCCCCCTTTCATGG - Intronic
1118311056 14:64693337-64693359 CCTTCCTTTACCTACCTCCAGGG - Intergenic
1118604520 14:67492944-67492966 CCTGGCCTTCCCCATCTTCATGG - Intronic
1118820039 14:69339124-69339146 CATCCCTATCCCCAGCTACAGGG + Intronic
1118935027 14:70279861-70279883 CCTCCCTCCCCCCACTCTCAAGG - Intergenic
1119193814 14:72702403-72702425 CCTCCCTATCCCCAGCTCCAAGG - Intronic
1119620129 14:76125663-76125685 CTTCCCTTTGTCCACCTGCAAGG + Intergenic
1119756536 14:77124004-77124026 CCTGCCTTCCCCCACCCCCATGG + Intronic
1120287120 14:82518074-82518096 CTTCCCTTTCCCTAACTGCATGG - Intergenic
1120697967 14:87665467-87665489 GCCCCCTTTCTCCATCTTCAAGG - Intergenic
1121518600 14:94570355-94570377 CCTCAGTTTCCCCACCTTTCTGG + Intronic
1121533686 14:94676587-94676609 CCACCTCTTCCCCACCTTTAAGG + Intergenic
1121782085 14:96628437-96628459 CCACCCTGTCCCCGCCCTCACGG - Intergenic
1122119633 14:99545227-99545249 CCTGCCTCTCCCCAGCTTCAGGG + Intronic
1122235214 14:100327436-100327458 CCTCAGTTTCCCCACCTGCCAGG - Intronic
1122470096 14:101960633-101960655 CCACCCCATCCCCACATTCATGG - Intergenic
1122565361 14:102650571-102650593 CTTCCCTTTCCCAACATCCAAGG - Intronic
1122826675 14:104374069-104374091 CCGCCCCCTCCTCACCTTCAAGG + Intergenic
1122885483 14:104708580-104708602 CCTCCCCGTCCCCACCTCCTTGG - Exonic
1122908464 14:104814506-104814528 ACTCCATTTCCCTGCCTTCAAGG + Intergenic
1122979476 14:105185185-105185207 CCGCCCCCTCCTCACCTTCAAGG + Intergenic
1123121253 14:105918084-105918106 CCTCCCTCCTCCCTCCTTCAGGG - Intronic
1123121821 14:105920280-105920302 CCTCCCTGTTCACACCTTGAGGG + Intronic
1123466090 15:20517086-20517108 CCTTCCTTTCCTCACCATGAAGG + Intergenic
1123652024 15:22483953-22483975 CCTTCCTTTCCTCACCATGAAGG - Intergenic
1123742444 15:23292813-23292835 CCTTCCTTTCCTCACCATGAAGG - Intergenic
1123760881 15:23431673-23431695 CCTTCCTTTCCTCACCATGAAGG + Intergenic
1123798634 15:23798564-23798586 TCTACCTTTCCCCACCCTCTTGG - Intergenic
1124167402 15:27340090-27340112 CCTCCCTTTCCCCATCTGCAAGG + Intronic
1124276814 15:28333062-28333084 CCTTCCTTTCCTCACCATGAAGG + Intergenic
1124305886 15:28578544-28578566 CCTTCCTTTCCTCACCATGAAGG - Intergenic
1125281015 15:38042809-38042831 CCTCCGAGGCCCCACCTTCAGGG + Intergenic
1125553590 15:40566129-40566151 CCTCCCCATCCCCAGCTTCCAGG + Intergenic
1125587140 15:40828880-40828902 CCTCCCTTTCTGCAGCTTCTAGG + Intergenic
1126432572 15:48601885-48601907 CCTCCATCTCTCCACATTCACGG + Intronic
1126703779 15:51389019-51389041 CCTCTCATTCCCTGCCTTCAAGG + Intronic
1127046552 15:55032164-55032186 CCTCACTTTCCTCACCTATAAGG - Intergenic
1127120302 15:55766160-55766182 CGTCCCTTTTTCCATCTTCAAGG + Intergenic
1128074037 15:64815234-64815256 CCTCCACTTCCCCACCTCCCGGG + Intergenic
1128155463 15:65389043-65389065 CCTCCCTTCTTCCTCCTTCATGG + Intronic
1129460954 15:75699894-75699916 CCTCCTTTCCCCCACTTTCCTGG + Intronic
1129688242 15:77698493-77698515 CCGCCCCTTCCCCAACTACACGG - Intronic
1129723865 15:77891823-77891845 CCTCCTTTCCCCCACTTTCCTGG - Intergenic
1129981365 15:79874322-79874344 TCCCCCTCTCCCCAGCTTCATGG + Intronic
1130065284 15:80597623-80597645 CCTCCATTTTGCCACTTTCAAGG - Exonic
1130371959 15:83292547-83292569 CCTTCCTTTCCCAACACTCACGG - Intergenic
1130872688 15:87983742-87983764 CCTCCATTTCACCCCCTTCCTGG - Intronic
1132497409 16:270451-270473 CCTCCATGTCCCCACCCTCAAGG - Intronic
1132754462 16:1475793-1475815 CCACCCTGTCCCCACCTTCTGGG + Intergenic
1132849009 16:2015837-2015859 CTTCCTTCTCCCCACCTCCAGGG - Intronic
1133049730 16:3110607-3110629 ACCCACCTTCCCCACCTTCAGGG - Intergenic
1133294299 16:4743427-4743449 CCTCCTCTTCCCCACCTCCCTGG + Intronic
1133425402 16:5684177-5684199 CCATCCTCTCCCCACCTCCAGGG - Intergenic
1135063571 16:19290670-19290692 CTGCCCTGTCCCCATCTTCAAGG - Intronic
1135138672 16:19903543-19903565 CTTCCCTTCTCCCACCTCCAAGG + Intergenic
1136016313 16:27403289-27403311 TCTTCCTTTCCCATCCTTCAAGG - Intronic
1136377121 16:29872275-29872297 TCTCCCTTTCCCAGGCTTCAGGG - Exonic
1136590821 16:31216653-31216675 CTTCCTGTTCCCCTCCTTCAGGG - Intronic
1138444419 16:57054673-57054695 CCTCCCTTTCCTTACCCTCCAGG + Intronic
1138505201 16:57475060-57475082 CCTCCCCCTCCCCACCCCCAGGG + Intronic
1139079988 16:63505929-63505951 CCTGCCTTTCCCAGCCTTGAAGG + Intergenic
1139318200 16:66091396-66091418 CCTGTCTTCCCCCACCTCCAGGG + Intergenic
1139917931 16:70439412-70439434 CCTCCGTCTCCCCTCCTGCACGG - Intergenic
1140255932 16:73336382-73336404 CCTCCCACCCCCCACCCTCAGGG + Intergenic
1140410398 16:74737602-74737624 CCACTCTGTCCCCACCTTCTAGG + Intronic
1140467889 16:75196804-75196826 CCCACCTTTCTCCAGCTTCATGG + Intergenic
1140759317 16:78097097-78097119 CCTTCCTCTCCCCACAATCAGGG + Intergenic
1140801368 16:78491408-78491430 TCTCCCTTTCCCCACACTGATGG + Intronic
1140864714 16:79050020-79050042 CCTCCCATTCCAGACCTCCAGGG - Intronic
1141523727 16:84598357-84598379 GCTCCCTTTACCTACCTTCAGGG - Intronic
1141926491 16:87173648-87173670 CCTCCCTTTCCCCTTCCTCTTGG + Intronic
1141983698 16:87565907-87565929 CCTCCCTGTCCCTCCCCTCAGGG + Intergenic
1142749153 17:1977399-1977421 CCTGCCCTTCCCCACCTTCGGGG + Intronic
1143250008 17:5516229-5516251 CCCTCCTTTCTCCACCTACATGG - Intronic
1143284786 17:5781060-5781082 CCTCCCTTTCACCACCCCCTGGG - Intronic
1143599203 17:7932851-7932873 CATCCCTTTCCCCAGCTCCTGGG - Exonic
1144740581 17:17580076-17580098 CCTCCCTTCCCCTCCCTTCAGGG - Intronic
1144862632 17:18315129-18315151 CCCCTCTTTCCCCTCCTTCCCGG + Intergenic
1145721993 17:27082346-27082368 CCTTCCTTTCCCACCCTCCATGG - Intergenic
1146643730 17:34562529-34562551 CCACCTGTTCCCCACCTACATGG - Intergenic
1146910915 17:36647889-36647911 CCTCCCTGGCCACACCTGCAGGG - Intergenic
1146922093 17:36720583-36720605 CCTCGCCTCACCCACCTTCAGGG - Intergenic
1148026366 17:44591679-44591701 CCTCCCCTGCCCAACCTTCAGGG - Intergenic
1148123219 17:45224236-45224258 CCTCTCATTCCCCACCAGCAGGG + Intronic
1148357603 17:46986123-46986145 CCCCCCTTGCCCCACCCCCAGGG - Intronic
1148874302 17:50677596-50677618 GCTGCCTTCCCCCACCTCCAAGG - Intronic
1149523810 17:57338809-57338831 CCTCCCTGTCTTCACCTACAGGG + Intronic
1150132564 17:62677248-62677270 TCTCCCTTCCCTCTCCTTCAGGG + Exonic
1150234970 17:63585621-63585643 CCTCCCTTTCCCCATATTCCTGG - Intronic
1150571280 17:66389268-66389290 CCTCTCTTCCCTCCCCTTCAAGG - Intronic
1151148926 17:72066995-72067017 CCTCCTTAGCCCCACCTTCTGGG + Intergenic
1151617592 17:75224473-75224495 CCACCCCTTCTCCACCATCATGG - Intronic
1151942280 17:77300371-77300393 ACAACCTTTCCCCACCCTCAAGG - Intronic
1152044075 17:77924506-77924528 CCTCCCACTCCCCTCCTTCTGGG + Intergenic
1152292609 17:79448817-79448839 TCTCCCTCTCCCCACCTGGACGG + Intronic
1152297831 17:79478637-79478659 CCTCCCCTTCACCACTCTCATGG - Intronic
1152924862 17:83082225-83082247 CTTTCCTTTCCCCACCTTGCAGG - Intronic
1153511313 18:5855904-5855926 CCTCCCTTTACCCAGCACCAAGG - Intergenic
1157239473 18:45996194-45996216 CTTGCCTTTCCCCACCTTCTTGG - Intronic
1158495431 18:57951003-57951025 CCTCAGTTTCCCCATCTTTAAGG + Intergenic
1159569080 18:70091458-70091480 CCTCCCCTGCCCCACATGCATGG + Intronic
1159973194 18:74678395-74678417 TCTCCCTTTCCTCTCCTTCCAGG + Intronic
1160159478 18:76460349-76460371 CCTCCCTGTTACCACCTTCCAGG + Intronic
1160672584 19:373361-373383 CCTCCCTTGCCCCATCTCCTCGG - Intronic
1160870240 19:1274627-1274649 CCTCCCTTCCTCCTCCTTCCAGG + Intronic
1160951250 19:1668715-1668737 CCTGCATTTCCCCACATGCAGGG + Intergenic
1160951933 19:1671979-1672001 CCTCGGTTTCCCCACCTCCCAGG - Intergenic
1161087810 19:2343271-2343293 CATCCGTCTGCCCACCTTCAAGG + Exonic
1161542677 19:4861440-4861462 CCTGCCTGGCCCCACCTTCCAGG + Intronic
1161868302 19:6850830-6850852 ACCCCCTTTTCCCACATTCAGGG + Intronic
1162744564 19:12791364-12791386 CCTCCCCTTCCCCACGCTCGAGG + Intronic
1162763915 19:12906196-12906218 CATCCCTTTCCCAACCTACTGGG + Intronic
1162934972 19:13977780-13977802 GGTGCCTTTCCCAACCTTCAAGG + Intronic
1163189196 19:15664061-15664083 CCCTCCTTTACCCACCTCCATGG + Intergenic
1163664275 19:18595701-18595723 CCTCCGTTTCCCCATCTGGAAGG - Intronic
1163810688 19:19429619-19429641 CCTGCCTGTCTCCTCCTTCAAGG + Intronic
1164392722 19:27839894-27839916 CCTCCCCTACCCCTCCATCAGGG + Intergenic
1164444871 19:28308293-28308315 GCTCCTCTTCCCCAGCTTCAGGG + Intergenic
1165138558 19:33685889-33685911 CCTCCCTTCCCACACCTTAGGGG + Intronic
1165359341 19:35325984-35326006 CCTCCTTTTCCTCCCCTTCTGGG + Intronic
1165722723 19:38090963-38090985 CCTCCCTCTACCCACCTTTCTGG + Intronic
1165778340 19:38417933-38417955 CCTCCCTTCCCCCTCCTTTCCGG - Intronic
1166158550 19:40934399-40934421 CCTCCACTTCCCCACGCTCAAGG + Intergenic
1166820537 19:45576690-45576712 CCTCCCTTCCTCCATCTTCAAGG + Intronic
1166856027 19:45783009-45783031 CCACCCCTTCCCCACCTCCTGGG - Exonic
1166976580 19:46608460-46608482 CCATCCTTTCCCCACCTTCCAGG + Exonic
1167200390 19:48061272-48061294 CCTCCCTTCCCCTCCCCTCATGG - Intronic
1167215473 19:48161507-48161529 CCCCCATTTCCCCACCTTCCAGG - Exonic
1167449003 19:49556247-49556269 CCTCCCCTTCACCCCCTCCAAGG - Intronic
1167792205 19:51689581-51689603 CCTCCCTTTCCGCAGACTCACGG - Intergenic
1167943517 19:52966804-52966826 TCTTCCTTTCTCCACCATCATGG - Intergenic
1168347090 19:55655229-55655251 CCTCGCTTCCCCCCACTTCACGG + Intronic
925285519 2:2713136-2713158 CCTTCCTTGCCCCATCTTCCAGG + Intergenic
925326211 2:3023925-3023947 CTTCCCTCTCTCCATCTTCAAGG - Intergenic
925595727 2:5553580-5553602 CCTCCTCTTCCCCACCTCCTTGG - Intergenic
925714205 2:6770164-6770186 CCTCCCTGACCCCTCCTGCAGGG - Intergenic
927127343 2:20024166-20024188 CCTCTCTTCTCCCTCCTTCAGGG - Intergenic
927174132 2:20393439-20393461 CCTTCCTCTCCCCACCTTTGTGG - Intergenic
927202432 2:20586314-20586336 CAGCCCCTTCCCCAGCTTCAAGG - Intronic
927337337 2:21940508-21940530 CCTGCATCTTCCCACCTTCATGG - Intergenic
928361176 2:30663470-30663492 CCTCACTTCCACCTCCTTCAAGG - Intergenic
929626236 2:43410720-43410742 CCTCCCCTCCCCCACCTCCCTGG - Intronic
930710273 2:54544264-54544286 CCTGCCTTTTCCAACCTTCTTGG + Intronic
931958549 2:67455816-67455838 CCTCTCTCTCTCCACCTTTATGG - Intergenic
932110303 2:68993154-68993176 CCTCCCGTTCCTCAGCTTCAGGG - Intergenic
932166243 2:69510194-69510216 CCTCCCACCCTCCACCTTCAAGG + Intronic
932474424 2:71992964-71992986 CCTCCATCTCCCCACAGTCAAGG + Intergenic
932586941 2:73036339-73036361 CCTCCCTTCCCCCAGCCTCCTGG - Intronic
932624714 2:73288164-73288186 CCTCCCTTCCCATACCTTCTGGG - Intergenic
933797068 2:85928065-85928087 CTTCCCTAACCTCACCTTCACGG - Intergenic
933999529 2:87696156-87696178 TCACCCTTTCTCCAGCTTCATGG + Intergenic
935046651 2:99489560-99489582 CCTCCCCTTCCCTTCCGTCATGG - Intronic
935686374 2:105687597-105687619 CCATCCCTTCCCCACATTCATGG + Intergenic
935759864 2:106310791-106310813 CCTCCCTTTCCCTGACTTCCCGG + Intergenic
936079718 2:109423892-109423914 CCTCCATTTCCCCACCTGCTTGG - Intronic
936288355 2:111199062-111199084 CCTCACTTTCCTCACTTTGAGGG - Intergenic
936294325 2:111254736-111254758 TCACCCTTTCTCCAGCTTCATGG - Intergenic
937795776 2:126018538-126018560 CCTCTATTTCCCCACCTCCCAGG + Intergenic
937969120 2:127536095-127536117 CCTGCCGTTCCCCTCCTGCAGGG - Intronic
938833274 2:135074103-135074125 CATCCCTTTCCCCTCCTACCTGG - Intronic
940635273 2:156291696-156291718 CCTCCTTCTCTCCACCATCAAGG + Intergenic
943475425 2:188348522-188348544 CCTCCTTATACCCATCTTCATGG - Intronic
944154309 2:196593881-196593903 CCTCGGTTTCCCCAACTGCAAGG + Intergenic
944900280 2:204206839-204206861 TCTCCCTTTCACTATCTTCAGGG + Intergenic
944983393 2:205147577-205147599 CCTCCCTCTACCCCCTTTCATGG + Intronic
946140382 2:217685382-217685404 CCTCTCTTTCGACACCTCCAGGG + Intronic
946249812 2:218405264-218405286 CCTCCCTCCCCCCAACTTCTGGG - Exonic
946564238 2:220945675-220945697 CCTCCCTGACCCCCCATTCAGGG + Intergenic
946945824 2:224821144-224821166 CCTCCCTTACCCCACATTATGGG - Intronic
947105422 2:226663422-226663444 CCTACCTTCCCCCAACTTCCTGG + Intergenic
948148057 2:235723458-235723480 CCACACTCTCCCCACCTGCAGGG - Intronic
948464271 2:238144770-238144792 CCTCCCTTTCCCCACCAGTGAGG + Intronic
948567212 2:238894676-238894698 GATCCCTCTCCCCACCTTCCTGG + Intronic
948784070 2:240341857-240341879 CCTGCCTTTCACAGCCTTCAAGG + Intergenic
949073215 2:242039192-242039214 CTTCCCTCTCCCCATCTCCAGGG - Intergenic
1168804261 20:663406-663428 CCCCCCTGTCCGCGCCTTCAAGG - Exonic
1168893857 20:1310640-1310662 CCTCCCTTCCCCTCCCTCCAAGG - Intronic
1168907583 20:1418327-1418349 ACTCCCCATCCCCAGCTTCAAGG + Intergenic
1169074845 20:2754195-2754217 CCTTCCACTCCCCACGTTCAGGG + Intronic
1172109873 20:32538490-32538512 CCTCCCTCCCTCCTCCTTCATGG + Intronic
1172229944 20:33329913-33329935 CCTCCCTGTGCCCAACATCAGGG + Intergenic
1172468716 20:35175515-35175537 TCCCCCTTCCCCCACCATCATGG + Intronic
1172812834 20:37662038-37662060 GCTCCCTTCCTCCATCTTCAAGG + Intergenic
1172952979 20:38733858-38733880 TCTTCCTTTCCCTACTTTCAAGG + Intergenic
1173640954 20:44601461-44601483 CCTCCCTTTTCCCAGGTTCTTGG + Intronic
1174231205 20:49046717-49046739 CCGCCCTTTCCTCTCCATCACGG + Intronic
1174264696 20:49322969-49322991 CCTCCTTTCCCCCATCTTCTGGG - Intergenic
1174285315 20:49468712-49468734 CCTCTCTCTTTCCACCTTCAAGG - Intronic
1174736322 20:52969208-52969230 CCTTCCTTTCGCCAAGTTCAGGG + Intergenic
1175350256 20:58312947-58312969 CCTGCCTGTCCCTACCTGCATGG + Intronic
1175488905 20:59365446-59365468 CTTCTCTTCCCCCACCATCAGGG + Intergenic
1177797949 21:25798665-25798687 CCTGCATTTCCCCACCTGTAAGG + Intergenic
1178976854 21:37227708-37227730 CCTCTCTGTCCCCATCTACATGG - Exonic
1179085419 21:38212460-38212482 GCTCCCTCTCCACACCTTCTTGG + Intronic
1179186226 21:39087199-39087221 CCTGACTGTCCCCACCTGCAAGG - Intergenic
1179403166 21:41102798-41102820 CCTCTGTTTTCCCACCTGCAGGG - Intergenic
1179548975 21:42131347-42131369 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179548985 21:42131383-42131405 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179548995 21:42131419-42131441 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179549004 21:42131455-42131477 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179549013 21:42131491-42131513 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179549023 21:42131527-42131549 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179549033 21:42131563-42131585 CCTCCTGCTCCCCAGCTTCATGG - Intronic
1179549043 21:42131599-42131621 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179549053 21:42131635-42131657 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179818371 21:43922426-43922448 CCTCCTTAACCCCACCCTCAAGG + Intronic
1179818387 21:43922482-43922504 CCTCCTTAACCCCACCCTCAAGG + Intronic
1179964462 21:44793371-44793393 CCACCCTTTCCCCTCCCTAAGGG - Intronic
1179989542 21:44940050-44940072 CCTCACTTTCCCCATCTTCCCGG - Exonic
1181441929 22:22941270-22941292 CCTCTCCTTCCACACCCTCATGG - Intergenic
1181466826 22:23114895-23114917 TCTCCCTTTCCTCACCTCCCTGG - Intronic
1181643781 22:24219543-24219565 CATCAGTTTCCCCACCTCCATGG + Intergenic
1182062184 22:27406188-27406210 CCTCAGTTTCCCCACCTGGAAGG - Intergenic
1182356629 22:29725080-29725102 CCTCCCTTTCCTCCTCTGCAGGG - Intronic
1182365467 22:29775865-29775887 CCTACCTCTTCCCACCTGCATGG - Intergenic
1182501834 22:30753560-30753582 CCTCCCATCCACCACCTTCCTGG - Intronic
1182601481 22:31468248-31468270 CCTCTCTCTACCCAGCTTCAGGG - Exonic
1183080685 22:35454184-35454206 CTTCCCCTTCACCACCTTCCTGG + Intergenic
1183414418 22:37674374-37674396 CCTCCCAGTCCCCACTCTCAAGG - Intergenic
1183645525 22:39124011-39124033 CCTCCCCTGCTCCACCTTCTTGG + Intronic
1184026996 22:41865297-41865319 CCCTCCTTTCCAAACCTTCAAGG - Intronic
1184175746 22:42787892-42787914 CCTCCCTTTCCCAGCCTGCCTGG - Intergenic
1184578267 22:45392669-45392691 CCTCCATATCCACACTTTCATGG - Intronic
1184729465 22:46364859-46364881 CCTCAGTTTCCCCACCTTTAGGG - Intronic
1185065050 22:48627965-48627987 CCTCCATTTCCCCGCCTGGATGG - Intronic
1185284350 22:49993766-49993788 CCTCCCCAGCCCCACCTCCACGG + Intergenic
949948695 3:9211426-9211448 CCTCTTTCTCCCCAGCTTCAAGG - Intronic
950153533 3:10706752-10706774 ACTCAGTTTCCCCACCTTCTAGG - Intronic
950231406 3:11279135-11279157 CCTCCCTTTCTCAACCATCAGGG + Intronic
950326706 3:12117179-12117201 TGTCCTTTTCCCCACCTTCATGG + Intronic
950708484 3:14798486-14798508 CAGCTCTTTCCCCTCCTTCAAGG - Intergenic
951079061 3:18429614-18429636 GCTTCCTTTCCCCAAGTTCAAGG - Intronic
953381495 3:42476113-42476135 TCTCCTATTCCCCACTTTCAAGG - Intergenic
953889052 3:46736856-46736878 CCTCAGTTTCCACACCTCCAGGG - Intronic
953891623 3:46755722-46755744 GCTCCCCTTCCACACCTTCCAGG + Intronic
953925152 3:46979062-46979084 CCCCCCATTCCCCAACTCCAGGG - Intronic
954264461 3:49461725-49461747 CCTTTCTTTTCCCACCTACAGGG + Intergenic
954593313 3:51802647-51802669 CCTCCCTAACCCCACCCACAAGG - Intergenic
954812199 3:53255380-53255402 CCTCCGTTTCCCCATCTGGAAGG + Intronic
955814284 3:62825578-62825600 CCTCACTTTCCTCACCAACAAGG - Intronic
956352956 3:68358576-68358598 CCTCATTATCCCCACCTCCAAGG + Intronic
957008646 3:74980318-74980340 CCTCCCTCTCCCTAGTTTCAAGG - Intergenic
957386475 3:79502493-79502515 CCGCCCCTTCCCCACCGCCATGG + Intronic
960597664 3:119421416-119421438 CCTCCCCCTCCCCACCTTTGTGG - Intergenic
960638995 3:119809634-119809656 CCTCGATTTCCCCTCCTTAAGGG - Intronic
960702637 3:120451928-120451950 CCTCACTTCCCCCAGCTTCAGGG + Intergenic
961721634 3:128900741-128900763 CCTCCCTTTCCCTGCCTGCTAGG - Intronic
962345756 3:134618091-134618113 CTTCCCTTTTCTCACTTTCAAGG - Intronic
963487451 3:145953107-145953129 CTTCCCTTTCCCATCCTTCTTGG - Intergenic
964176261 3:153828194-153828216 CCACCCTTTCTCCACTTTCCTGG - Intergenic
965897800 3:173598849-173598871 CCTCCCTCTGCCCATTTTCATGG + Intronic
966294936 3:178408580-178408602 CTTACCTTTCCTCATCTTCAAGG + Intergenic
968066427 3:195761975-195761997 CCTCCCTTTCTCCGCCTCCTTGG - Intronic
968137138 3:196227746-196227768 CCTGCCTCGCCCCACCTCCAAGG + Intronic
968522438 4:1040028-1040050 CCTCAGTTTCCCCACCTCCCTGG - Intergenic
968623912 4:1618039-1618061 CCTCCATCTTCCCATCTTCACGG - Intronic
969421868 4:7102247-7102269 CTTCCCTTTCCTCACCCTCCAGG + Intergenic
969463095 4:7339120-7339142 CCCTCCTGTCCCCACCCTCACGG - Intronic
969620934 4:8278569-8278591 CCTCCCTTCCCCCTGATTCATGG + Intronic
970521215 4:16885782-16885804 ACTCCCTATCCCCAACTTGAGGG - Intronic
970740758 4:19234967-19234989 CCTCCCTTCACACACATTCATGG + Intergenic
970980604 4:22092203-22092225 CCACCCCATCCCCAGCTTCAAGG + Intergenic
973723684 4:53750941-53750963 CTCCCCTGTCCCCTCCTTCAAGG - Intronic
974302757 4:60090077-60090099 CCTCCCTATCTCCACCCTCAGGG + Intergenic
976061902 4:81138208-81138230 CCCCCATTCCCCCAGCTTCAAGG - Intronic
976414482 4:84756809-84756831 CATCACTTTCCCCACATTTAAGG - Intronic
976784413 4:88801811-88801833 CCTCCCCTACACCACTTTCATGG - Intronic
977898220 4:102388032-102388054 GCTCCCTTGCCTCATCTTCACGG + Intronic
979640944 4:123012209-123012231 CCACCCTTTCTCCACTTTCCTGG - Intronic
979739625 4:124132935-124132957 CTTCCCTTTCCCCATATTGAAGG + Intergenic
981255884 4:142660183-142660205 CCTCCCCATCCCCCACTTCATGG + Intronic
983071147 4:163269570-163269592 CCTCCCTTCACCCAGTTTCAGGG - Intergenic
983228429 4:165106798-165106820 CTTCCCTTTCCCCAGCTTGCAGG + Intronic
983439225 4:167759821-167759843 CCTCCCAATCTCCACCTTCAAGG - Intergenic
984481320 4:180306632-180306654 CCTCCCACTCCCCACCCTCTGGG + Intergenic
985349333 4:189040676-189040698 CCTCCTGCTCCCCACCTTAATGG - Intergenic
985550554 5:531414-531436 CCTCCCTCTCCTCCCCTCCAGGG + Intergenic
985813746 5:2111222-2111244 CCACCCTCTACCCACCATCAAGG + Intergenic
985880713 5:2636905-2636927 CCACCTTCTCCCCACCTCCATGG - Intergenic
987344199 5:16964279-16964301 CTTCACTTTCTCCACCTTCCAGG + Intergenic
988513124 5:31882448-31882470 CCTCCCTCTCCCCTTCTTTATGG - Intronic
990025084 5:51178339-51178361 CCTGCCTTTCCCCATGTTCCTGG - Intergenic
990287217 5:54311664-54311686 CCCCCCCATCCCCACCCTCAGGG + Intergenic
990441320 5:55848177-55848199 CCTCTCTTCTCCCACCTTCAGGG - Intergenic
995269976 5:110208897-110208919 CCTCCCATCCTCCCCCTTCAAGG + Intergenic
996290946 5:121851931-121851953 CCTCAGTTTCCCCACTTCCAAGG + Intergenic
997594775 5:135099799-135099821 GATCCCTCTCCCCACCTTCCAGG + Intronic
998077441 5:139247969-139247991 CCTGCCTTTCCCCATCTTGGGGG - Intronic
998353550 5:141516265-141516287 CCACCTTTACCCCACCTTCCTGG - Exonic
998471925 5:142390263-142390285 TCTCCCTCTCCCCAGCTTCTAGG - Intergenic
999179263 5:149657361-149657383 CCTTCCTCTCCTCACCTTCTGGG + Intergenic
999220492 5:149972378-149972400 TCTCCCTTTCTCTACATTCATGG - Intronic
999715469 5:154356650-154356672 TCTCCCTTCTCCCACCTTCAGGG - Intronic
999861317 5:155649735-155649757 CCTCACTTGCCCCACCTTATTGG - Intergenic
1000073988 5:157767729-157767751 CCTCCATTTGGCCACCCTCAAGG - Intergenic
1000196357 5:158962793-158962815 CCTCCCTTTCCACTTCTTTAAGG + Intronic
1000414362 5:160967776-160967798 CTTCCCTTTCACCCCCTTCTGGG + Intergenic
1000997470 5:167973905-167973927 CCTCCCTTTCCACCTCTTCATGG - Intronic
1001203537 5:169741204-169741226 CCACCTCTTCCCCACCATCAAGG - Intronic
1001427303 5:171631163-171631185 CCTCCCTTTGCACACCTTCATGG + Intergenic
1001829247 5:174771688-174771710 TTCCCCTTTCCCCACCTTCGTGG - Intergenic
1002595124 5:180317254-180317276 CCTCCCTTTCTCAAGCTGCAGGG - Intronic
1003617439 6:7668442-7668464 CCTCCCTTTCCCTCACTTCCAGG + Intergenic
1003823062 6:9922204-9922226 CATCCATTTCCCCTCCTTAATGG + Intronic
1003852408 6:10238776-10238798 CTGCCCTATCCCCACCTTCCTGG + Intergenic
1004708303 6:18145191-18145213 CCTCACTTTCCCCACCAGCCTGG - Intronic
1004886786 6:20058949-20058971 CCTCAGTTTCCCCCACTTCATGG - Intergenic
1005040549 6:21596149-21596171 GCTCCCATCCCCCACCTTCCCGG + Exonic
1005856391 6:29866356-29866378 CCTCACTGTCCTCACCTCCATGG + Intergenic
1005983617 6:30856319-30856341 CCTCCCTTGTTCCACCATCAGGG + Intergenic
1006067419 6:31471945-31471967 TCTCCCTGTCCTCACCTCCATGG - Intergenic
1006076329 6:31534853-31534875 CCTCCCCTTCCCCACCTCCAGGG - Intronic
1006459598 6:34150688-34150710 CCTCAGTTTCCCCACCTATAGGG + Intronic
1006535724 6:34697064-34697086 CCGCCCCGTCCCCACCCTCAAGG + Intergenic
1006583875 6:35092770-35092792 CATTCCTTTCTCCCCCTTCAGGG + Intergenic
1006738579 6:36292180-36292202 CCTTCCTTCCCCCACATACAGGG + Intronic
1007097242 6:39221022-39221044 CCTGCTTTGCCCCACCTTCAAGG + Intronic
1007112657 6:39321919-39321941 CTTCCCCTTCCCCAACTCCAGGG - Intronic
1007205504 6:40146800-40146822 ACACCCTTTCACCACTTTCAGGG - Intergenic
1007286805 6:40753720-40753742 CCTCCCTCTCTCCACCATCCTGG - Intergenic
1007394679 6:41570681-41570703 CCTCCCTCACCTCCCCTTCATGG + Intronic
1007628905 6:43261993-43262015 CCTGCCTTTCCCATCCTACAAGG - Intronic
1007762000 6:44138753-44138775 CCTGCCCTGCCCCACCTTGAGGG + Intronic
1007781743 6:44258309-44258331 CCCCCCGTTCCTCACCTTCGAGG - Exonic
1007932723 6:45706991-45707013 TCTCCCTGTCCCTACCTCCAGGG - Intergenic
1011215750 6:85004007-85004029 ACTCCCTTTTCCCACTTTCCAGG + Intergenic
1011599780 6:89049260-89049282 TCTTCCTTACCCCACCTCCATGG + Intergenic
1012446307 6:99310483-99310505 CCTCCCGCTCCCCACCTCCCTGG + Intronic
1013288521 6:108700104-108700126 CCCCCTTCACCCCACCTTCAGGG - Intergenic
1013975812 6:116077359-116077381 CCAGCCCTTCCCCACCTTGATGG + Intergenic
1014295331 6:119610597-119610619 CCTCCCTTTCAACATCTTCCAGG - Intergenic
1014926514 6:127277346-127277368 CAACCCTTTCACCAACTTCAAGG - Intronic
1015397515 6:132751808-132751830 ATTCCCTTTCCCCACCTTTCAGG - Intronic
1015579203 6:134705122-134705144 AATCCCTTTCCCAACTTTCAAGG + Intergenic
1015804445 6:137094096-137094118 AATCCCCTTCCCCATCTTCAAGG - Intergenic
1016317381 6:142805520-142805542 CCTTCCTTTGCTCATCTTCAGGG + Intronic
1016726683 6:147378585-147378607 CTTCCCTTTCCACACCCTCTAGG - Intronic
1016912405 6:149212044-149212066 TCTCCCTTTCCAAGCCTTCATGG - Intergenic
1017224866 6:152009102-152009124 CCTCCCTTCCCCCACCCCCTGGG + Intronic
1017716734 6:157218309-157218331 GCTGCCCTTGCCCACCTTCAGGG + Intergenic
1018450480 6:163902768-163902790 CCTTCCCAGCCCCACCTTCAGGG - Intergenic
1019521924 7:1464761-1464783 CCCCCCCCCCCCCACCTTCAAGG + Intergenic
1019636414 7:2078440-2078462 CCTCCCCTGCCCCACGCTCACGG + Intronic
1019817177 7:3209887-3209909 CCTCCCACTCTCCACCCTCAAGG + Intergenic
1022518010 7:30987971-30987993 CAGCCCCTTCCCCACCTTCATGG - Intronic
1023342896 7:39240973-39240995 CCTTCCTCTGCCCACCTTCTTGG + Intronic
1023958337 7:44905820-44905842 CCTGGCTGTCCCCACCATCAGGG + Intergenic
1024009984 7:45259226-45259248 CATTCCTTTCCCCACATGCAAGG - Intergenic
1024955095 7:54910326-54910348 CCTGCCTTTCCCCTCCTGCAAGG + Intergenic
1025159983 7:56648798-56648820 TCCCACTTTCCCCACCTCCACGG - Intergenic
1025241932 7:57283906-57283928 CCTCTATTTCCCCAACTTGAAGG - Intergenic
1026166698 7:67916399-67916421 CCTCCCTTTCCCCAACTTGAAGG - Intergenic
1026193552 7:68151568-68151590 CCTCTCATTCTCCACCCTCAAGG - Intergenic
1027157603 7:75779892-75779914 CCACCCTTTCTCCACTTTCCTGG + Intronic
1028860690 7:95646840-95646862 CCTCCCTTTCTCCACCCTCAAGG + Intergenic
1028990870 7:97047371-97047393 CCTCCCTTCCCCCAACTCCTAGG - Intergenic
1029185326 7:98734189-98734211 CCCCACTTTCCCCACCCCCACGG - Intergenic
1029251008 7:99236347-99236369 CCTCCAGTTCCCCTCCTTCCTGG + Intergenic
1032054746 7:128675283-128675305 CCTCACTTTCCTCTCCTTCTGGG + Intronic
1033347176 7:140534586-140534608 CCTCCCATCCCCCTCCTTGAGGG - Intronic
1033818226 7:145101447-145101469 CCCCCCTTTCCACACACTCACGG + Intergenic
1034224330 7:149471114-149471136 CTTCCCTTTTCCAACCTTTAAGG - Intergenic
1034901295 7:154909578-154909600 CCACCCTTTCCACTCCTGCAGGG + Intergenic
1035061813 7:156074980-156075002 GCTCCCTTTCGCCTCCATCAGGG - Intergenic
1035440508 7:158893239-158893261 CCTCCCTTCCCCCTTATTCATGG + Intronic
1036654970 8:10672008-10672030 CCTCCCAATCGCCGCCTTCAGGG + Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1037595791 8:20353126-20353148 CATCCCTTTGCCCACTATCAGGG - Intergenic
1038376762 8:27047685-27047707 CATCCCTTTTCCCAGCCTCAAGG - Intergenic
1038611279 8:29061864-29061886 CCGCCCTGTGCCCACCCTCAAGG - Intronic
1039884257 8:41646360-41646382 CCTCCCCTTCCCCACGCTCCTGG - Exonic
1039899515 8:41741118-41741140 CCTCCCCTCCCCTACCTCCATGG - Intronic
1039924370 8:41915862-41915884 CCTTCCTTTCACCTCCGTCATGG + Intergenic
1039947789 8:42144829-42144851 CCTCCCTTTCCCCTGCTTTTGGG + Intergenic
1041586137 8:59522079-59522101 CCTCCCCCTCTCCACCCTCAAGG - Intergenic
1043769612 8:84182660-84182682 CCTCTCTTTCGCCGTCTTCAAGG - Intergenic
1043823473 8:84896686-84896708 TCTCCTTGTCCCCACATTCAGGG - Intronic
1044304467 8:90621866-90621888 CCTCCCTATCCCCTCAATCAAGG + Intergenic
1044599653 8:93991118-93991140 CCTGGCTTTACCCACCTTCCTGG - Intergenic
1045068980 8:98480093-98480115 TCTCTCATTCCCCACCTTCTGGG - Intronic
1045244287 8:100429425-100429447 CCTCTCTTTCACACCCTTCAAGG + Intergenic
1045341264 8:101256771-101256793 CCTCCCTCTCCCTTCATTCACGG + Intergenic
1047625219 8:126649365-126649387 CTTCCCACTTCCCACCTTCATGG + Intergenic
1048692719 8:136986135-136986157 CCTTCCTGTCCTCAGCTTCAAGG - Intergenic
1048881500 8:138876163-138876185 CCTCCCTTTCCCCAGCTGCACGG + Intronic
1050129034 9:2390319-2390341 CCTCACTTTCCAAACCTACATGG - Intergenic
1050470665 9:5986121-5986143 CCTCCCTCTACCCACCTTACAGG + Intronic
1051132561 9:13878607-13878629 CCTCCATTCCCCCCCCATCACGG - Intergenic
1051138386 9:13950401-13950423 CCTCCTACTCCCCACCTTCCAGG - Intergenic
1051502249 9:17790579-17790601 CCTCCCCATCCCCAAATTCATGG + Intronic
1053121008 9:35547538-35547560 CTTCCCTTCCTCCACTTTCAGGG - Exonic
1053312500 9:37028382-37028404 CCTCCCTCACTCCACCTGCAGGG + Intronic
1053448208 9:38169699-38169721 CATGCCTTTCCCCCTCTTCAAGG + Intergenic
1053727821 9:41022140-41022162 CCTCGCTTTCCCCATCTAGAAGG - Intergenic
1054453867 9:65419948-65419970 CCTTCCCCTCCCCACCTTCCTGG - Intergenic
1054700692 9:68409967-68409989 CCTCGCTTTCCCCATCTAGAAGG + Intronic
1055407148 9:75987203-75987225 CCTGCCCTTCCCCACCTCCTTGG + Intronic
1055895920 9:81175522-81175544 CCTCCCTCACCCCAGCTTAAAGG - Intergenic
1056108523 9:83371794-83371816 CCTCCCTCTTCCATCCTTCAAGG - Intronic
1056262674 9:84864340-84864362 CCACCCTTTCCCCACAGTCCCGG - Intronic
1056507697 9:87272963-87272985 CCTCCCACCCTCCACCTTCAAGG - Intergenic
1057044911 9:91878269-91878291 CCTCCCTTTCCTGGGCTTCAGGG + Intronic
1057771858 9:97975212-97975234 GCTCCCTTCCTCCACCTTCGAGG + Intergenic
1057915761 9:99053908-99053930 GTTCCCTTTCCCCACCTTGATGG - Intronic
1058316898 9:103580212-103580234 CCTCTTTTTCCCCATCTTCCTGG - Intergenic
1058438291 9:104984330-104984352 CCTCCACTTCCTCATCTTCAAGG + Intergenic
1059429506 9:114241407-114241429 GCTCCTTTTCCCCAGCTTCCAGG - Intronic
1059658944 9:116382382-116382404 TCTCCCTTTCCAGCCCTTCATGG + Exonic
1059763292 9:117359849-117359871 TCTCTCTTTCCCTACTTTCAGGG - Intronic
1059826532 9:118035728-118035750 CCTCCATTCCCCAACCTCCAGGG - Intergenic
1060139914 9:121201327-121201349 CCTCGCCTTCCCCGCCTTCTCGG - Intronic
1060552659 9:124492885-124492907 CAGCCCTTTCCCCACGTTCATGG - Intronic
1061009029 9:127944454-127944476 CCTCCCTTTCCCCATCTGTCAGG - Intronic
1061904667 9:133690568-133690590 CCTCTCTGTCCCCACCTCCCAGG - Intronic
1061919820 9:133776591-133776613 CCTCAGTTTCCCCATCTGCATGG - Intronic
1187301264 X:18052393-18052415 CCTCCCATCCTCCACCCTCAAGG + Intergenic
1187736514 X:22310536-22310558 GCTCACTTTCCCTCCCTTCATGG + Intergenic
1189749771 X:44208483-44208505 CCTCCCTTTCTCCCCCTTTTTGG - Intronic
1190012732 X:46799194-46799216 TCTCCCTTTCCCACCTTTCAAGG - Intergenic
1191900945 X:66040182-66040204 CCCCCCTTCCCCCACCTCCTTGG + Intergenic
1194785052 X:98073090-98073112 CCTCCTTTTCTCCACTTTGAAGG - Intergenic
1194871856 X:99142070-99142092 CTTCCCTTTCCCCACCACCATGG - Intergenic
1194912003 X:99657048-99657070 CCTCCATTGCTCAACCTTCATGG + Intergenic
1195252013 X:103058171-103058193 CTTCCATTGCCCCACCTCCATGG + Intergenic
1195467676 X:105197910-105197932 CCTCCCACTCTCCACCCTCAAGG + Intronic
1197252426 X:124229682-124229704 GCTCCCTTTCCCCACAGACATGG + Intronic
1197553395 X:127923041-127923063 CCTCCCTCCATCCACCTTCAAGG - Intergenic
1199051201 X:143239042-143239064 TCTCCCCATCCCCACCATCAGGG + Intergenic
1199054044 X:143271363-143271385 GCTCACTTTCTCCATCTTCAAGG + Intergenic
1199262795 X:145795166-145795188 CCTCTCTTTCCCCATATGCAGGG + Intergenic
1200058561 X:153473990-153474012 CATCCCTTCCCCCATCTGCAAGG - Intronic
1201557847 Y:15283256-15283278 CCTCCCTTCCTCCCTCTTCATGG - Intergenic