ID: 1115637030

View in Genome Browser
Species Human (GRCh38)
Location 14:35299676-35299698
Sequence CAGGGTAAACAGTAGTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115637030_1115637034 7 Left 1115637030 14:35299676-35299698 CCATGATACTACTGTTTACCCTG 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1115637034 14:35299706-35299728 TTCTTTAAAAGATACTCTTTAGG 0: 1
1: 0
2: 3
3: 64
4: 611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115637030 Original CRISPR CAGGGTAAACAGTAGTATCA TGG (reversed) Intronic
900314331 1:2049672-2049694 CAGGGAAAACCGTATTTTCAGGG + Intergenic
907021752 1:51072896-51072918 AGGGGTAAAAAGTAATATCAAGG + Intergenic
907749742 1:57251327-57251349 CATGATTAACAGTAATATCAAGG - Intronic
907803734 1:57797311-57797333 CAGGGTAAAGGGGAGAATCAAGG + Intronic
910329416 1:86053516-86053538 CACGGTAAACTCTAGTTTCATGG - Intronic
911831537 1:102555820-102555842 AAGGCTAAACAAAAGTATCAAGG + Intergenic
916551577 1:165854845-165854867 CAGGAAAAACAGAAGTATAAAGG - Intronic
917250473 1:173054328-173054350 CATGATAAACAGTGGTATTAGGG - Intergenic
918025873 1:180745510-180745532 CAGTGAGAACAGTAGTAACAGGG - Intronic
920364309 1:205440087-205440109 CAGGGGAGACAGGAGAATCAAGG + Intronic
922176322 1:223200697-223200719 CAGGGTAAACAAGAGTGACAAGG - Intergenic
922933062 1:229404915-229404937 CTGGATAAACAGAAGTATTATGG + Intergenic
1063127820 10:3150887-3150909 CAGGGTAAACATTAGGAAAAAGG + Intronic
1069027131 10:63554839-63554861 CAGAGTACACTGTAGAATCAAGG - Intronic
1069345561 10:67465610-67465632 AAGGGCATACAGTATTATCAAGG - Intronic
1069855336 10:71437550-71437572 CAAAGTAAACAGTAGCCTCACGG + Intronic
1070602151 10:77873481-77873503 CGGGGTAAACAGAATTATCAGGG - Intronic
1070636503 10:78132476-78132498 CAGAGCAAACAATATTATCAGGG - Intergenic
1071273408 10:84029860-84029882 CAGGGGAAGCAGTATTCTCAGGG - Intergenic
1071619812 10:87108981-87109003 CAGGGGCTACAGTAGTAGCAGGG - Intronic
1072602919 10:96947634-96947656 CAGGTAAAACAGTAAGATCAGGG + Intronic
1074088961 10:110228693-110228715 CAGGGTATAAAGCAGAATCAAGG + Intronic
1076391089 10:130102812-130102834 CAGGGTAAAGAATATTACCATGG - Intergenic
1077925362 11:6676949-6676971 TATGGGAAACAGTAGTATGAAGG + Intergenic
1080998615 11:37638610-37638632 CAGGATAAACAATATTATTAAGG - Intergenic
1082085545 11:48046698-48046720 CAGGGGAAAATGTAGTAACATGG - Intronic
1084554151 11:69865755-69865777 CATGGTAAACATAAGAATCAGGG - Intergenic
1084899789 11:72300926-72300948 CAAGGTAAACAGTGGTATGGGGG + Intronic
1085422915 11:76379660-76379682 TAGGGGAATAAGTAGTATCAAGG - Intronic
1088061924 11:105663979-105664001 CAAGGTAAATATTATTATCATGG - Intronic
1091516758 12:1191937-1191959 CTGAATAAACAGTAGAATCATGG + Intronic
1094274873 12:28661829-28661851 CAGTGTAAACAGTGCTAACAGGG + Intergenic
1096800127 12:54105055-54105077 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1101309902 12:103567520-103567542 CTGGGTAAACAATAATATAAAGG + Intergenic
1105303094 13:19152437-19152459 CAGGGCAAGCAGCAGTGTCAGGG + Intergenic
1106345555 13:28873548-28873570 CAGGATAAACACTAGTGTTAAGG - Intronic
1109184579 13:59253155-59253177 AAGGCTAAAAAGTAGAATCATGG + Intergenic
1110718707 13:78737532-78737554 CAGGGAAACCAGCAGGATCACGG + Intergenic
1111715710 13:91876864-91876886 CAGAGGAAAAAGTAGTTTCATGG + Intronic
1115637030 14:35299676-35299698 CAGGGTAAACAGTAGTATCATGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118437665 14:65786378-65786400 CAGGGTAAACAAGAGCAACAAGG + Intergenic
1118998453 14:70859015-70859037 CAGGGTAAATATTATTCTCATGG + Intergenic
1119610771 14:76060066-76060088 CAGGGAAAACAGTACTAACAAGG + Intronic
1121807600 14:96844368-96844390 CTTGGAAGACAGTAGTATCATGG - Intronic
1123781031 15:23628769-23628791 TAGGGTAAACAGAAGTAACTGGG - Intronic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124121640 15:26893682-26893704 CAGGGGAAACAGGAGGATCTGGG + Intronic
1128499190 15:68215408-68215430 CATGGTAAGAAGTACTATCAGGG - Intronic
1131368401 15:91859362-91859384 CAGGAAAAACAGTGGAATCATGG + Intronic
1131804134 15:96104230-96104252 CAGGAAAAACAGTATTATGAGGG - Intergenic
1133827544 16:9291709-9291731 CTGGGTAAACAGTCTCATCAGGG + Intergenic
1134033284 16:11009752-11009774 CAGGGGAAACTGAAGTACCAAGG - Intronic
1135628182 16:24014363-24014385 CAGGGTGTACAGTAGTTTCAGGG - Intronic
1137025057 16:35465742-35465764 CAGTGTAAGTAGTAGTGTCAGGG - Intergenic
1142103094 16:88285918-88285940 CAGGGTCAGCAGGAGTCTCATGG - Intergenic
1150117490 17:62566638-62566660 CAGTGTAAACAGCAGTTACATGG + Intronic
1150588606 17:66540805-66540827 GAGGGTAATTATTAGTATCATGG + Intronic
1156986356 18:43355352-43355374 CAGGGTCAACAGTAGGATCTGGG - Intergenic
1164667198 19:30048583-30048605 CAGCCCAAACAGTATTATCAGGG + Intergenic
927291885 2:21412762-21412784 CAGAGTAAAGAAAAGTATCATGG + Intergenic
928859076 2:35834028-35834050 CAGGGAAAACAGGAAAATCATGG + Intergenic
928975089 2:37078250-37078272 CATAATAAACAGTAGAATCAGGG + Intronic
930343535 2:50148691-50148713 CAGTGTGAACAGTAGCATCAGGG - Intronic
930879573 2:56255888-56255910 CAGGGTTAACATTGGTAACAAGG + Intronic
932533200 2:72560731-72560753 CAGAGTATACAGTGCTATCAAGG - Intronic
936385561 2:112025379-112025401 CAGGGTAAATAATAGTGTGAGGG - Intronic
936990529 2:118360039-118360061 CAGAGTAAAAAGTATTATAAAGG - Intergenic
937445538 2:121955021-121955043 CAGGGCTACCAGAAGTATCAAGG - Intergenic
937638782 2:124188251-124188273 TAGGAAAAACAGTAGTAACAAGG + Intronic
939337979 2:140855604-140855626 GAGGGTAAATGGTAGTAGCAGGG - Intronic
941606458 2:167603427-167603449 CAGGGAAAACATTAGTATCCTGG + Intergenic
941684610 2:168435805-168435827 TAGGGAAAACAGTAAGATCAAGG - Intergenic
943970782 2:194403772-194403794 AAGGAAAAAAAGTAGTATCAGGG - Intergenic
944727939 2:202490745-202490767 AAGGGTAAAGAGTAGGATTAGGG + Intronic
947269044 2:228313121-228313143 CAGGGTGAAAAGTAAGATCAAGG - Intergenic
1171851916 20:30314881-30314903 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1174674936 20:52344661-52344683 AAGGGTCAAGAGTAGCATCAGGG + Intergenic
1177240392 21:18448035-18448057 CATTATAAACAGTAGTATAAAGG + Intronic
1177333606 21:19694704-19694726 CAGGGGCAACAGAAGTAGCATGG + Intergenic
1177634849 21:23774042-23774064 AAGGGTAAAATGTTGTATCAGGG + Intergenic
1177724979 21:24955614-24955636 GAGGGGAAACAGTAGGATAAGGG - Intergenic
1178841650 21:36142455-36142477 CAGGGTCCAAAGTAGGATCATGG - Intronic
1182699584 22:32224717-32224739 CAGTGTAGACAGTAGTGTCCTGG - Intronic
1183460026 22:37944260-37944282 CAGGGAAAGCAGGTGTATCAGGG + Intronic
1184932881 22:47694084-47694106 AAGGGCAAACAGAATTATCATGG + Intergenic
949115748 3:320401-320423 GAGGTTAAACAGTAGTCTGATGG + Intronic
949710959 3:6870621-6870643 AAGGGCAAAGAGTAGTATCTGGG + Intronic
951705329 3:25538703-25538725 GAGGGAAAACACTAGAATCATGG + Intronic
954153487 3:48671702-48671724 CAGGGTTAAAAGTAGTAACCAGG + Intergenic
956418142 3:69054676-69054698 AAGGGTAATCAGTAGTTCCATGG - Intergenic
958606401 3:96364151-96364173 CAGGGCAGACTGTAGTATGATGG - Intergenic
960219683 3:115091153-115091175 CAGAGTAAATAGTATTATAATGG - Intronic
966715515 3:183010105-183010127 CAAGGTAATCATTGGTATCAGGG + Intergenic
967934610 3:194716849-194716871 AAGGGGAAACAGAAGTACCAAGG + Intergenic
968695658 4:2024957-2024979 CAGGATAAACAGTGGCAGCATGG + Intronic
971272256 4:25160939-25160961 ATGGCTAAACAGTAGTGTCAAGG - Intronic
972732562 4:41809213-41809235 AAGGGGAAACAGTAGTAGGAAGG - Intergenic
973787780 4:54349629-54349651 CAGAATAAACAGTAGGAACATGG + Intergenic
974920458 4:68232906-68232928 CAGAGTAAAGAGAATTATCATGG - Intronic
978751293 4:112250650-112250672 CAGGGTCAACATTTTTATCAGGG - Intronic
982128530 4:152205709-152205731 CAGGGGAAACAATAGCATCTGGG + Intergenic
986341668 5:6794352-6794374 CAGGGTAAACATTATTCTGAGGG - Intergenic
989047635 5:37288251-37288273 CATGGTACAGAGTTGTATCAAGG - Exonic
992567105 5:78008730-78008752 GAAGGTTGACAGTAGTATCAGGG + Intronic
994441987 5:99819206-99819228 CAGGGTTATCAGAAGTATTAAGG + Intergenic
999468608 5:151831116-151831138 CTGGGAAAAGAGTAGTATCTGGG - Intronic
1002689235 5:181038716-181038738 CTGCATAAACAGTAGGATCAGGG - Intergenic
1004763276 6:18695193-18695215 CATGGTCCACAGTAGTATAAAGG - Intergenic
1006196820 6:32248484-32248506 AAGGTTAAACAGTAGTGTCGTGG + Intergenic
1006818591 6:36871914-36871936 CAGGGCAGACAGGAGTATTATGG + Intronic
1007209595 6:40181700-40181722 CAGGGTAAGAAGTAGGATTAGGG + Intergenic
1011612457 6:89166958-89166980 CAGGATTAACAGTAGCCTCATGG + Intergenic
1015281863 6:131442849-131442871 CAAGGAAAACACTAGGATCATGG - Intergenic
1016543192 6:145190063-145190085 CTGGTTATACAGTATTATCAGGG - Intergenic
1020107082 7:5427112-5427134 CTGGGTAAACAAAAGTATGAGGG - Intergenic
1024909780 7:54433564-54433586 CAGGGCAAAAAGTAGATTCATGG + Intergenic
1026246343 7:68623311-68623333 CAGGATAAACAGCAGTGCCAAGG - Intergenic
1028767650 7:94578058-94578080 CAGGAAAAACAGTAGAATCTTGG - Intergenic
1030880992 7:114879487-114879509 CAGGGAAAACAGTACTAAGAGGG - Intergenic
1031546677 7:123059361-123059383 CAGGGGGAACTGTAGGATCAGGG - Intergenic
1032782884 7:135178248-135178270 CAGTTCAAACAGTAGGATCATGG + Intergenic
1037158111 8:15731255-15731277 CAGGATAAAAAATAGTAGCAGGG + Intronic
1038998662 8:32954890-32954912 CAAGTTAAACACTAGTAGCATGG - Intergenic
1040594470 8:48824133-48824155 CAGTGTATACAGTTGTAACAGGG + Intergenic
1044836276 8:96298524-96298546 AAGGGGAAACAGTAAGATCAAGG - Intronic
1048016157 8:130499390-130499412 CAGGCTATGCTGTAGTATCAAGG + Intergenic
1048158534 8:131988909-131988931 CAGGGTAAAAAGAAATAACAGGG - Intronic
1049199866 8:141334735-141334757 CCTGGTAAACAGTAGGAGCACGG + Intergenic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1050062449 9:1724133-1724155 CAGGGCAAACAGAGGTATCAGGG - Intergenic
1053789702 9:41678135-41678157 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054155442 9:61636618-61636640 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054178040 9:61889825-61889847 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054475227 9:65567728-65567750 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054659489 9:67690999-67691021 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1055013187 9:71589501-71589523 CTGGGTAAACAGTAATATAAGGG - Intergenic
1056623125 9:88231842-88231864 CAGAGTAAAAAGTAGGTTCAAGG - Intergenic
1060544381 9:124451673-124451695 CAGAGGAAACAGTAGCACCACGG - Intronic
1061970878 9:134044776-134044798 CAGGGAAAACAGGAGTGTCTTGG - Intronic
1189592864 X:42534131-42534153 CAGAGTTCACAGTAGGATCAGGG + Intergenic
1190931950 X:54956282-54956304 CAGGGAGAACAGAGGTATCAAGG + Intronic
1191724136 X:64261086-64261108 CAGTGTAATCAGCAGCATCAGGG + Intergenic
1198131324 X:133698140-133698162 CAAGGTAAACAGTATCATAAGGG + Intronic
1198180215 X:134200626-134200648 CAGAGTAAAAACTATTATCAGGG - Intergenic