ID: 1115640567

View in Genome Browser
Species Human (GRCh38)
Location 14:35333162-35333184
Sequence TCACAGAGTCCCTCCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115640567_1115640570 -8 Left 1115640567 14:35333162-35333184 CCTTCCTGGGAGGGACTCTGTGA No data
Right 1115640570 14:35333177-35333199 CTCTGTGAGTGCCACGCCCAGGG No data
1115640567_1115640572 4 Left 1115640567 14:35333162-35333184 CCTTCCTGGGAGGGACTCTGTGA No data
Right 1115640572 14:35333189-35333211 CACGCCCAGGGCCCTGCAGCAGG No data
1115640567_1115640569 -9 Left 1115640567 14:35333162-35333184 CCTTCCTGGGAGGGACTCTGTGA No data
Right 1115640569 14:35333176-35333198 ACTCTGTGAGTGCCACGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115640567 Original CRISPR TCACAGAGTCCCTCCCAGGA AGG (reversed) Intergenic
No off target data available for this crispr