ID: 1115640569

View in Genome Browser
Species Human (GRCh38)
Location 14:35333176-35333198
Sequence ACTCTGTGAGTGCCACGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115640567_1115640569 -9 Left 1115640567 14:35333162-35333184 CCTTCCTGGGAGGGACTCTGTGA No data
Right 1115640569 14:35333176-35333198 ACTCTGTGAGTGCCACGCCCAGG No data
1115640560_1115640569 6 Left 1115640560 14:35333147-35333169 CCAGCTTCCAGGCCTCCTTCCTG No data
Right 1115640569 14:35333176-35333198 ACTCTGTGAGTGCCACGCCCAGG No data
1115640565_1115640569 -1 Left 1115640565 14:35333154-35333176 CCAGGCCTCCTTCCTGGGAGGGA No data
Right 1115640569 14:35333176-35333198 ACTCTGTGAGTGCCACGCCCAGG No data
1115640566_1115640569 -6 Left 1115640566 14:35333159-35333181 CCTCCTTCCTGGGAGGGACTCTG No data
Right 1115640569 14:35333176-35333198 ACTCTGTGAGTGCCACGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115640569 Original CRISPR ACTCTGTGAGTGCCACGCCC AGG Intergenic
No off target data available for this crispr