ID: 1115640570

View in Genome Browser
Species Human (GRCh38)
Location 14:35333177-35333199
Sequence CTCTGTGAGTGCCACGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115640560_1115640570 7 Left 1115640560 14:35333147-35333169 CCAGCTTCCAGGCCTCCTTCCTG No data
Right 1115640570 14:35333177-35333199 CTCTGTGAGTGCCACGCCCAGGG No data
1115640567_1115640570 -8 Left 1115640567 14:35333162-35333184 CCTTCCTGGGAGGGACTCTGTGA No data
Right 1115640570 14:35333177-35333199 CTCTGTGAGTGCCACGCCCAGGG No data
1115640565_1115640570 0 Left 1115640565 14:35333154-35333176 CCAGGCCTCCTTCCTGGGAGGGA No data
Right 1115640570 14:35333177-35333199 CTCTGTGAGTGCCACGCCCAGGG No data
1115640566_1115640570 -5 Left 1115640566 14:35333159-35333181 CCTCCTTCCTGGGAGGGACTCTG No data
Right 1115640570 14:35333177-35333199 CTCTGTGAGTGCCACGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115640570 Original CRISPR CTCTGTGAGTGCCACGCCCA GGG Intergenic
No off target data available for this crispr