ID: 1115645252

View in Genome Browser
Species Human (GRCh38)
Location 14:35364814-35364836
Sequence AAGAGTCGTTTGAACTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115645246_1115645252 13 Left 1115645246 14:35364778-35364800 CCACCATAGTCCTAGCTACTCAG No data
Right 1115645252 14:35364814-35364836 AAGAGTCGTTTGAACTCTGGAGG No data
1115645247_1115645252 10 Left 1115645247 14:35364781-35364803 CCATAGTCCTAGCTACTCAGAAG 0: 15
1: 144
2: 1265
3: 3432
4: 4611
Right 1115645252 14:35364814-35364836 AAGAGTCGTTTGAACTCTGGAGG No data
1115645245_1115645252 30 Left 1115645245 14:35364761-35364783 CCAGGTATGATGGCGCACCACCA No data
Right 1115645252 14:35364814-35364836 AAGAGTCGTTTGAACTCTGGAGG No data
1115645249_1115645252 3 Left 1115645249 14:35364788-35364810 CCTAGCTACTCAGAAGGCTGAGG 0: 4034
1: 105705
2: 210194
3: 239846
4: 148354
Right 1115645252 14:35364814-35364836 AAGAGTCGTTTGAACTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115645252 Original CRISPR AAGAGTCGTTTGAACTCTGG AGG Intergenic
No off target data available for this crispr