ID: 1115645697

View in Genome Browser
Species Human (GRCh38)
Location 14:35367254-35367276
Sequence CTGTCTGCAAATGTGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115645686_1115645697 13 Left 1115645686 14:35367218-35367240 CCCTGCAGGGAGCCTGAGGTGGA No data
Right 1115645697 14:35367254-35367276 CTGTCTGCAAATGTGGAGCCGGG No data
1115645682_1115645697 22 Left 1115645682 14:35367209-35367231 CCAGGGCCACCCTGCAGGGAGCC No data
Right 1115645697 14:35367254-35367276 CTGTCTGCAAATGTGGAGCCGGG No data
1115645684_1115645697 16 Left 1115645684 14:35367215-35367237 CCACCCTGCAGGGAGCCTGAGGT No data
Right 1115645697 14:35367254-35367276 CTGTCTGCAAATGTGGAGCCGGG No data
1115645692_1115645697 1 Left 1115645692 14:35367230-35367252 CCTGAGGTGGAGGGGCCTGGCTA No data
Right 1115645697 14:35367254-35367276 CTGTCTGCAAATGTGGAGCCGGG No data
1115645687_1115645697 12 Left 1115645687 14:35367219-35367241 CCTGCAGGGAGCCTGAGGTGGAG No data
Right 1115645697 14:35367254-35367276 CTGTCTGCAAATGTGGAGCCGGG No data
1115645681_1115645697 23 Left 1115645681 14:35367208-35367230 CCCAGGGCCACCCTGCAGGGAGC No data
Right 1115645697 14:35367254-35367276 CTGTCTGCAAATGTGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115645697 Original CRISPR CTGTCTGCAAATGTGGAGCC GGG Intergenic
No off target data available for this crispr