ID: 1115648105

View in Genome Browser
Species Human (GRCh38)
Location 14:35384187-35384209
Sequence GACCCCTTTGGCCCTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115648105_1115648109 6 Left 1115648105 14:35384187-35384209 CCTCAAGGAGGGCCAAAGGGGTC No data
Right 1115648109 14:35384216-35384238 TTCCCAGCCAGCCCCAACCTGGG No data
1115648105_1115648112 11 Left 1115648105 14:35384187-35384209 CCTCAAGGAGGGCCAAAGGGGTC No data
Right 1115648112 14:35384221-35384243 AGCCAGCCCCAACCTGGGACAGG No data
1115648105_1115648108 5 Left 1115648105 14:35384187-35384209 CCTCAAGGAGGGCCAAAGGGGTC No data
Right 1115648108 14:35384215-35384237 CTTCCCAGCCAGCCCCAACCTGG No data
1115648105_1115648119 28 Left 1115648105 14:35384187-35384209 CCTCAAGGAGGGCCAAAGGGGTC No data
Right 1115648119 14:35384238-35384260 GACAGGAATGTGGCGTCCCCTGG No data
1115648105_1115648116 18 Left 1115648105 14:35384187-35384209 CCTCAAGGAGGGCCAAAGGGGTC No data
Right 1115648116 14:35384228-35384250 CCCAACCTGGGACAGGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115648105 Original CRISPR GACCCCTTTGGCCCTCCTTG AGG (reversed) Intergenic
No off target data available for this crispr