ID: 1115651451

View in Genome Browser
Species Human (GRCh38)
Location 14:35405011-35405033
Sequence CAGGCTGCAGGGAAGTACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115651451_1115651464 24 Left 1115651451 14:35405011-35405033 CCCCGGTACTTCCCTGCAGCCTG No data
Right 1115651464 14:35405058-35405080 AAGTGAGCCTTCTTTCCCTGGGG No data
1115651451_1115651463 23 Left 1115651451 14:35405011-35405033 CCCCGGTACTTCCCTGCAGCCTG No data
Right 1115651463 14:35405057-35405079 CAAGTGAGCCTTCTTTCCCTGGG No data
1115651451_1115651462 22 Left 1115651451 14:35405011-35405033 CCCCGGTACTTCCCTGCAGCCTG No data
Right 1115651462 14:35405056-35405078 GCAAGTGAGCCTTCTTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115651451 Original CRISPR CAGGCTGCAGGGAAGTACCG GGG (reversed) Intergenic
No off target data available for this crispr