ID: 1115654364

View in Genome Browser
Species Human (GRCh38)
Location 14:35429434-35429456
Sequence TGTACCACGGCACCCCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115654364_1115654367 9 Left 1115654364 14:35429434-35429456 CCAAGCTGGGGTGCCGTGGTACA No data
Right 1115654367 14:35429466-35429488 CAGTGCAGCCTCCGCCTCCCGGG 0: 13
1: 2351
2: 46222
3: 186555
4: 232308
1115654364_1115654366 8 Left 1115654364 14:35429434-35429456 CCAAGCTGGGGTGCCGTGGTACA No data
Right 1115654366 14:35429465-35429487 TCAGTGCAGCCTCCGCCTCCCGG 0: 24
1: 2694
2: 49809
3: 175523
4: 163867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115654364 Original CRISPR TGTACCACGGCACCCCAGCT TGG (reversed) Intergenic
No off target data available for this crispr