ID: 1115656003

View in Genome Browser
Species Human (GRCh38)
Location 14:35444413-35444435
Sequence GGCCACCATGATGGAACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115656003_1115656013 19 Left 1115656003 14:35444413-35444435 CCACCAGTTCCATCATGGTGGCC No data
Right 1115656013 14:35444455-35444477 TAATCCTAATTATTTCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115656003 Original CRISPR GGCCACCATGATGGAACTGG TGG (reversed) Intergenic
No off target data available for this crispr