ID: 1115658678

View in Genome Browser
Species Human (GRCh38)
Location 14:35468484-35468506
Sequence GCTGATCTGCAGAATGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115658674_1115658678 27 Left 1115658674 14:35468434-35468456 CCAAAATTGCATCTGATGGCCTC 0: 1
1: 29
2: 7
3: 8
4: 96
Right 1115658678 14:35468484-35468506 GCTGATCTGCAGAATGATGAAGG 0: 1
1: 0
2: 0
3: 23
4: 196
1115658677_1115658678 8 Left 1115658677 14:35468453-35468475 CCTCAAGGGTCATGTATTTGAAG 0: 1
1: 3
2: 4
3: 26
4: 223
Right 1115658678 14:35468484-35468506 GCTGATCTGCAGAATGATGAAGG 0: 1
1: 0
2: 0
3: 23
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115658678 Original CRISPR GCTGATCTGCAGAATGATGA AGG Intergenic
901680975 1:10912703-10912725 GCTGAGCTGGGGCATGATGAAGG - Intergenic
901722489 1:11210813-11210835 GCTCATCTGCAGAATTGTCAAGG - Exonic
904198101 1:28801143-28801165 GCTGAAATTCAGAGTGATGAAGG - Intergenic
904481123 1:30794011-30794033 GCTGATCTGAACAATGAAGAGGG - Intergenic
906000655 1:42421583-42421605 TCAGCTCTGCAGAATGATTAAGG - Exonic
906119589 1:43380094-43380116 GCTGAGCTGCAGATTCCTGATGG - Intergenic
906891336 1:49718708-49718730 GTTGATTTTCAGAATAATGAGGG + Intronic
908520275 1:64934888-64934910 GCTCATCAGATGAATGATGAGGG + Intronic
909118857 1:71575117-71575139 GCTGATCTACAGAGAGAGGAAGG + Intronic
910627224 1:89320166-89320188 GCTGATCTGTCCAATGCTGAAGG + Intergenic
912510281 1:110185051-110185073 GCTTCTCAGCAGGATGATGAAGG + Intronic
912723338 1:112038265-112038287 GGTGATGAGCAGAAAGATGAGGG - Intergenic
913271282 1:117096056-117096078 GCTAACCTTAAGAATGATGAGGG + Intronic
917750690 1:178050592-178050614 TTTGAGCTGGAGAATGATGAGGG + Intergenic
918961809 1:191288721-191288743 GGTGATTTGAACAATGATGATGG - Intergenic
923914962 1:238491796-238491818 GTCGATCTGCAGAATGATGCAGG - Intergenic
924155431 1:241170663-241170685 GCTGATGTGCAAAAGGCTGATGG + Intronic
924703772 1:246481195-246481217 ACAGATCTGCAGAAGGAAGATGG - Intronic
1066180288 10:32955848-32955870 TCTCATGTGCAGAATGTTGAGGG + Intronic
1067055740 10:43048843-43048865 GCAGATGTGCAGAATGACAATGG + Intergenic
1067209993 10:44252108-44252130 CCAGATCTGAAGAATGAGGATGG + Intergenic
1067932731 10:50579591-50579613 ACTGAGCTTCAGAATGGTGAAGG - Intronic
1068265247 10:54639971-54639993 GCTGATCTGGAGGCTGAGGAAGG + Intronic
1070685172 10:78475216-78475238 GCTGCTTTGCAGAAAGATGGAGG - Intergenic
1072308543 10:94131851-94131873 GCTCTTCTGCAGAGAGATGAAGG - Intronic
1073442361 10:103559629-103559651 GCTGAGATGCAGACAGATGAAGG - Intronic
1075200798 10:120402309-120402331 GCTAAGCTGGAGAATGATGGAGG + Intergenic
1077842948 11:5994699-5994721 GTCGATTTGCAGAATGATGCGGG + Intergenic
1080543297 11:33290562-33290584 TCTGATATGCAGAATAATGCAGG - Intronic
1080827580 11:35861071-35861093 GTCGATCTGCAGAATGATGTGGG + Intergenic
1081022243 11:37960528-37960550 GCTGATATGGAGAAGGCTGAGGG + Intergenic
1081210176 11:40323504-40323526 GCCGATTTTCAGACTGATGAAGG + Intronic
1083313050 11:61795512-61795534 GATGTGCTGCAGAATGAGGAGGG + Exonic
1084394909 11:68903333-68903355 GCTGGTCTGAAAAATGGTGATGG - Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1087607328 11:100392729-100392751 TCTGATCAGTAGAATTATGAGGG - Intergenic
1089592299 11:119550906-119550928 GCTGTTCAACAGAATAATGAAGG + Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1093936958 12:25011714-25011736 CCAGATCTGCTGAATCATGATGG - Intergenic
1096173863 12:49498085-49498107 GCTGATCTGCAACAGGCTGAGGG - Intronic
1096763151 12:53860532-53860554 CCAGATCTTCAGAAAGATGAAGG - Intergenic
1098084762 12:66830443-66830465 GCTGGCCTGCAGACAGATGAGGG + Intergenic
1098107434 12:67084107-67084129 GCTGATTTTCAGAATGATCCAGG - Intergenic
1099611896 12:84883820-84883842 GGTGATTAGCAGAATGAGGAAGG + Intronic
1101468998 12:104977564-104977586 GTCGATCTGCAGAACGATGCAGG + Intergenic
1103309370 12:119991970-119991992 GCTGACCTGCAGAGGAATGAAGG - Intronic
1107459373 13:40586670-40586692 GCTTATCAACAGAATGATCATGG + Intronic
1107536544 13:41340786-41340808 GCTGATCTGGAGACTGAGGCAGG - Intronic
1115658678 14:35468484-35468506 GCTGATCTGCAGAATGATGAAGG + Intergenic
1115956760 14:38789787-38789809 GCCCATGTGCAGTATGATGAGGG - Intergenic
1116861534 14:49999559-49999581 GGAGATCTGCAGACTGATAAGGG - Intronic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1120625806 14:86824710-86824732 CCTGATTTTCAGAAAGATGAAGG + Intergenic
1121820758 14:96964231-96964253 GCTAATCGGCCTAATGATGACGG + Intergenic
1122570222 14:102693169-102693191 CCTGATCTGCAGAATTAAGGAGG - Intronic
1124113889 15:26821605-26821627 GTTGCTCTGCAGAAAGAAGATGG + Intronic
1125591320 15:40856259-40856281 CCTTCTCTGCAGAATGATGAGGG - Exonic
1127065567 15:55234264-55234286 GATGTTCTGCAGAATGTTGAAGG - Intronic
1128780861 15:70357699-70357721 GCTGATGTGCAGATGGGTGATGG + Intergenic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1130603613 15:85295434-85295456 GCTGATCTGCAGCAGGGAGAGGG - Intergenic
1131641382 15:94297827-94297849 GCTGTTCTTCAGTATGATCAAGG - Intronic
1133083289 16:3340947-3340969 GCTGATCTTCAGATTCATAAGGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133932672 16:10244957-10244979 GCTGGGCTGCAGACTGGTGAAGG + Intergenic
1134422907 16:14111378-14111400 GCTCATCTGCTCAGTGATGAGGG + Intronic
1136998872 16:35211152-35211174 ACTGAACTGCAGACTGATTAAGG + Intergenic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1137767026 16:50985562-50985584 GCTGAAGTGGACAATGATGAAGG + Intergenic
1138968077 16:62110377-62110399 ATTGATCTTCAGAATGATGGAGG - Intergenic
1139011726 16:62643198-62643220 GCTGACCTGCAGAAACTTGAGGG + Intergenic
1139483489 16:67243866-67243888 GCTGAGCTGCAGACTGGTGAGGG - Intronic
1140306725 16:73809670-73809692 CCAGATCTGGAGACTGATGAGGG - Intergenic
1141623754 16:85250529-85250551 GCTGATCAGCAGCATAATAAAGG - Intergenic
1144656337 17:17039571-17039593 GCTGATCTGGAGAATGAATCAGG - Intergenic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145218002 17:21066634-21066656 GCTGATCTCCAGAATGGAGATGG + Intergenic
1145771004 17:27493071-27493093 CATCATCAGCAGAATGATGAAGG - Intronic
1147121148 17:38335810-38335832 GCTCCTCTGCAGAATGAAGGTGG - Intronic
1149936329 17:60810608-60810630 GTTGATTTGCAGAACGATGCAGG - Intronic
1153265393 18:3263732-3263754 GCTAATGTGTAGAATGAGGAAGG - Intronic
1153466088 18:5389374-5389396 GCTGATCTGTAAAATCAGGAAGG + Intergenic
1155876782 18:31099789-31099811 GCTGATTTGTGGAATGGTGAAGG + Intronic
1157126490 18:44961034-44961056 GCTGGTGTCCAGAATGATGAGGG + Intronic
1157347273 18:46850891-46850913 GCTGCTCCGAAGATTGATGAAGG - Intronic
1158561479 18:58517282-58517304 GCTGACCTGCAGAACCAAGAGGG + Intronic
1158657729 18:59355347-59355369 GCTGATCTGTGGAATGGTGTTGG - Exonic
1162725013 19:12684991-12685013 GCTGAGATGCAGAAAGATCAGGG - Intergenic
1162918963 19:13889289-13889311 CCTGGTCTGCAGAATGAGGCAGG + Exonic
1163316060 19:16541603-16541625 GTTGTTTTGCAGACTGATGACGG - Intronic
1163655279 19:18542274-18542296 CCTGTTCTGCAAAATGTTGAGGG - Intronic
1163986841 19:20961527-20961549 GTCGATCTGCAGAACGATGTGGG - Intergenic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
930698708 2:54438183-54438205 GCTCATCTGTAAAATGATAAGGG - Intergenic
932828219 2:74960460-74960482 TCTGATCTGTAACATGATGAGGG - Intronic
937133149 2:119528383-119528405 GCTGATCTGAAGAAGGCTTAAGG + Intergenic
937144395 2:119629939-119629961 TCTGACCTGCAGATTGAAGAAGG - Exonic
937942890 2:127301789-127301811 GTTGAGCTTCAGAAAGATGAGGG - Exonic
943548675 2:189312074-189312096 GTCGATCTGCAGAATGATGCTGG + Intergenic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944855738 2:203765122-203765144 GTCGATCTGCAGAATGATGCAGG + Intergenic
945688777 2:213007000-213007022 ACTGATATTCAGAATTATGATGG - Exonic
947363206 2:229367007-229367029 GATGATCAGCATAAGGATGAAGG + Exonic
948381601 2:237554099-237554121 AATGATCTGCTGAATAATGAAGG + Exonic
1169074690 20:2753408-2753430 GCTGATCTGGAACTTGATGATGG - Intronic
1169294857 20:4386286-4386308 GCTCAACAGCAGAATGAAGAGGG + Intergenic
1169619646 20:7491219-7491241 GGAGAAGTGCAGAATGATGAGGG - Intergenic
1169941170 20:10938875-10938897 TCAGATCTGCAGAATGAAGGGGG - Intergenic
1170119260 20:12894135-12894157 GCTGATATGCAGAGTGCTGAGGG - Intergenic
1170280126 20:14636978-14637000 GCTGAAATGCAGAATAATGATGG + Intronic
1172131563 20:32659495-32659517 GCTCATCTGTACAATGAAGATGG - Intergenic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1174349573 20:49957185-49957207 GTTGATCTGCAGAACAATGCAGG - Intergenic
1174519876 20:51121177-51121199 GATGTTCTGAAGATTGATGAGGG - Intergenic
1175417382 20:58810847-58810869 GGACATCTGCGGAATGATGATGG + Intergenic
1177387393 21:20425776-20425798 GTCGATCTGCAGAACGATGCAGG + Intergenic
1177890448 21:26798177-26798199 GCAGTACTGCAGGATGATGATGG - Intergenic
1182404663 22:30115784-30115806 GCTGAAGTGGAGAATGAAGAAGG + Intronic
1183158662 22:36095273-36095295 GCTGATCTGCAGCCCCATGAAGG - Intergenic
1183687829 22:39371890-39371912 TCTTATCTGCAAAATGCTGATGG + Intronic
1184448336 22:44567402-44567424 GTTGATCTGCAGAACAATGCAGG - Intergenic
949145566 3:695630-695652 AATGATGTGAAGAATGATGATGG + Intergenic
950252264 3:11475594-11475616 GCTGATCTGCAGACTGCAGAGGG - Intronic
950403344 3:12788208-12788230 GTTGATCTGCAGAACGATGCGGG + Intergenic
952309452 3:32174819-32174841 GCAGATATGTAGAATGATGTAGG - Intergenic
952450345 3:33426360-33426382 ACTGATTGGGAGAATGATGAGGG + Intronic
955931988 3:64066592-64066614 ACTGAACTGCAGAATGGAGAAGG + Intergenic
956931092 3:74043793-74043815 GCTCAGCTGCAGCATGATAAAGG + Intergenic
957579611 3:82054197-82054219 GATTATCTGAAGAATGATGATGG + Intergenic
960017752 3:112912217-112912239 GTTGATCTGCCTAATGTTGACGG - Intergenic
960272181 3:115687276-115687298 GCTGATCTTCACAATGAGTATGG + Intronic
961059746 3:123818271-123818293 TTTAATCTGCAGAATGATAAAGG - Intronic
962108853 3:132420702-132420724 ACTGTTCTGCAGATTCATGAAGG + Intronic
962243259 3:133769158-133769180 CATGAACTGCACAATGATGATGG + Intronic
962448183 3:135487468-135487490 GCTAGTCTGCTGAATGATGAGGG - Intergenic
963225870 3:142860981-142861003 GATGATCTCCAGAAAAATGAGGG - Intronic
963254542 3:143131706-143131728 GCTGGTCTGCAGATTGAGTATGG + Intergenic
965661352 3:171045435-171045457 GCTGATTTGCAGGGTGCTGAGGG + Intergenic
966581171 3:181565702-181565724 GATAACCTTCAGAATGATGAGGG + Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967278109 3:187796081-187796103 CCTCATCTGTTGAATGATGAGGG - Intergenic
967535035 3:190592370-190592392 GCTGTTGTGCAGAATAAGGAAGG - Intronic
967588978 3:191249606-191249628 GCTCATCTAAAGAAGGATGATGG - Intronic
967788428 3:193522088-193522110 GCTGAGCTGCAGTCTGATTATGG + Intronic
967922561 3:194623807-194623829 GCTGGCCTGCAGAATAATGTGGG - Intronic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
970473164 4:16396531-16396553 GCAGGTCTGCAGGATGATGGTGG + Intergenic
970617193 4:17779619-17779641 GCTGCTATGCTGAATGTTGATGG - Intronic
972538708 4:40020682-40020704 GTTGATCTACAGAAAGATGAAGG - Intergenic
972938594 4:44168986-44169008 GCTGAAGTGGAAAATGATGAAGG + Intergenic
976848986 4:89523515-89523537 ACTGAAATGCAGAAAGATGAAGG + Intergenic
977544603 4:98362594-98362616 TCTGATCTGCATGATTATGAAGG - Intronic
977600101 4:98926866-98926888 GCGGAACTGCAAAGTGATGAAGG - Intronic
978142634 4:105335029-105335051 TCTCATCTGTACAATGATGAAGG + Intergenic
984782254 4:183536598-183536620 GCTGAGCTGAAAGATGATGAGGG - Intergenic
985000909 4:185481587-185481609 GGCCATCTGCAGAATGAGGAGGG - Intergenic
985210266 4:187585496-187585518 ACTCATGTGCAGAATGATAAAGG + Intergenic
985286072 4:188337219-188337241 GCTGAGCTGCAGAAACTTGAGGG - Intergenic
987097558 5:14563456-14563478 GCTGAACTCCAGAATCATGCGGG - Intergenic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
989806624 5:45615768-45615790 TCTGATCAGAAGAAAGATGAAGG + Intronic
995215333 5:109588747-109588769 GTTGACCTGCAGAATGATGCGGG - Intergenic
996147511 5:119993862-119993884 GCTGATCTGCAGAGAAAGGAGGG - Intergenic
998167860 5:139854762-139854784 TCTGATGTGCTGAAAGATGACGG - Intronic
998918437 5:147041378-147041400 GCATAGCTGCAGAATGCTGAAGG - Intronic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001250230 5:170141480-170141502 GTTGATCTGCAGAACAATGCGGG + Intergenic
1002505950 5:179679226-179679248 CCGGATGTCCAGAATGATGAAGG + Exonic
1004953042 6:20695690-20695712 GCCATTCTGCAGAATGTTGAAGG + Intronic
1005711281 6:28505230-28505252 GCTGGTCTGCAGAACAATGCTGG - Intronic
1006465284 6:34190240-34190262 GTCAATCTGCAGAATGATGCTGG - Intergenic
1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG + Intronic
1008421201 6:51301134-51301156 GCAGATCTGGTGTATGATGAGGG + Intergenic
1009444838 6:63730040-63730062 GCTGATCTGAGGAAGGCTGAGGG - Intronic
1011483447 6:87818058-87818080 GCTAGCCTGCAGGATGATGATGG + Intergenic
1012763920 6:103339896-103339918 GTTGTTTTGCAGAATGATGTTGG - Intergenic
1015862208 6:137692737-137692759 GCTGCTGTTCAGGATGATGAAGG - Intergenic
1017582393 6:155880407-155880429 GCTGATGTGGACAATGATGTAGG - Intergenic
1018243479 6:161800905-161800927 AATGATCTGCAGAATGATTCTGG + Intronic
1018506721 6:164478680-164478702 GCCAGTCTGCAGAATGCTGATGG - Intergenic
1018641401 6:165907579-165907601 GCTGAGGAGCAGGATGATGAGGG - Intronic
1022961050 7:35427053-35427075 GCTGATTTTCACAATGATTATGG - Intergenic
1026267649 7:68809448-68809470 AGTGATCTGGTGAATGATGATGG + Intergenic
1027156528 7:75772170-75772192 CCTGATTTGCAGCATCATGATGG - Exonic
1029459051 7:100685068-100685090 GGAGATCTGGAGGATGATGAAGG - Exonic
1030020301 7:105268420-105268442 GCTGCTCTACAGAATTACGAAGG - Intronic
1032838459 7:135695403-135695425 GCTGACCACCAGCATGATGAGGG + Exonic
1034077393 7:148245423-148245445 GCTGATGTGGAGGAGGATGAAGG + Intronic
1034186831 7:149184548-149184570 GCTGCTCTGCAGAAGTATCATGG + Intergenic
1037113962 8:15201126-15201148 GCTGCTCTGCAGGCTGATGTGGG - Intronic
1039487656 8:37924259-37924281 GCTGCTCACCTGAATGATGAAGG - Intergenic
1041979995 8:63846557-63846579 GCTGACCTCCAGAATACTGAGGG + Intergenic
1043245018 8:77987840-77987862 GATTCTCTGCTGAATGATGACGG - Intergenic
1046886239 8:119370478-119370500 GCTGAACTCCATAGTGATGATGG + Intergenic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1048379380 8:133851180-133851202 GCTGATCTGCAGCCAGATGTGGG - Intergenic
1051948146 9:22597303-22597325 GCTGAACTGCAGAAGTGTGAAGG - Intergenic
1054804746 9:69387036-69387058 GCAGGTCTGCAGAATGAGAAGGG - Intronic
1056591296 9:87967981-87968003 GCAGATCTGAAGAGTCATGAGGG + Intronic
1057719690 9:97522010-97522032 GCTCATCTGTGAAATGATGATGG - Intronic
1058197762 9:101999888-101999910 GCTGATCTTCAGAATCATCTAGG + Intergenic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1060348596 9:122837986-122838008 GTCGATCTGCAGAATGATGCTGG - Intergenic
1060804355 9:126565119-126565141 GTTGATATTAAGAATGATGATGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1186792703 X:13014429-13014451 ACTTATCTGCAGAAGGATAAGGG - Intergenic
1186804333 X:13125075-13125097 GCTCAGCTGCTGAATGCTGAAGG + Intergenic
1187668868 X:21648404-21648426 GCTTATCAGCATAATGATAAGGG + Intronic
1188032320 X:25277724-25277746 GCAGATCAGCAGAATGCTGCTGG + Intergenic
1189214097 X:39308606-39308628 GTTGCTCTGCAGAATTAGGAGGG + Intergenic
1190153531 X:47968155-47968177 GCTGATCTGAAGTCTGTTGAGGG - Intronic
1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG + Intronic
1192580781 X:72279132-72279154 GCTCCTCTGCAGACTGCTGAGGG - Intronic
1193266341 X:79474743-79474765 GATGATCTGCCCACTGATGAAGG - Intergenic
1194703687 X:97148132-97148154 ACTGAGATGCAGAATGATAAAGG + Intronic
1199902520 X:152190427-152190449 GCTCATCTTCAGAATGAACATGG + Intronic
1200244850 X:154517432-154517454 GCTGCTCTCCAGACAGATGATGG - Intergenic