ID: 1115660885

View in Genome Browser
Species Human (GRCh38)
Location 14:35493601-35493623
Sequence TGGGGGAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115660878_1115660885 20 Left 1115660878 14:35493558-35493580 CCTTGGAAGCAGCCATGTGGCAC No data
Right 1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG No data
1115660879_1115660885 8 Left 1115660879 14:35493570-35493592 CCATGTGGCACGAAGAGAGAATT No data
Right 1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG No data
1115660874_1115660885 26 Left 1115660874 14:35493552-35493574 CCCATCCCTTGGAAGCAGCCATG No data
Right 1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG No data
1115660875_1115660885 25 Left 1115660875 14:35493553-35493575 CCATCCCTTGGAAGCAGCCATGT No data
Right 1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG No data
1115660877_1115660885 21 Left 1115660877 14:35493557-35493579 CCCTTGGAAGCAGCCATGTGGCA No data
Right 1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115660885 Original CRISPR TGGGGGAGCACAGTGATTGT GGG Intergenic