ID: 1115660885

View in Genome Browser
Species Human (GRCh38)
Location 14:35493601-35493623
Sequence TGGGGGAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 2, 1: 2, 2: 25, 3: 77, 4: 325}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115660879_1115660885 8 Left 1115660879 14:35493570-35493592 CCATGTGGCACGAAGAGAGAATT No data
Right 1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG 0: 2
1: 2
2: 25
3: 77
4: 325
1115660875_1115660885 25 Left 1115660875 14:35493553-35493575 CCATCCCTTGGAAGCAGCCATGT No data
Right 1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG 0: 2
1: 2
2: 25
3: 77
4: 325
1115660877_1115660885 21 Left 1115660877 14:35493557-35493579 CCCTTGGAAGCAGCCATGTGGCA No data
Right 1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG 0: 2
1: 2
2: 25
3: 77
4: 325
1115660878_1115660885 20 Left 1115660878 14:35493558-35493580 CCTTGGAAGCAGCCATGTGGCAC No data
Right 1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG 0: 2
1: 2
2: 25
3: 77
4: 325
1115660874_1115660885 26 Left 1115660874 14:35493552-35493574 CCCATCCCTTGGAAGCAGCCATG No data
Right 1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG 0: 2
1: 2
2: 25
3: 77
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115660885 Original CRISPR TGGGGGAGCACAGTGATTGT GGG Intergenic
900174206 1:1284631-1284653 TGGGGGTGCACAGTGTGTGCTGG + Intronic
901958988 1:12809868-12809890 TGAAGGAGCACAGTGATCCTCGG - Intergenic
902644952 1:17791573-17791595 TCGGGGTGCAGAGTGAATGTGGG + Intronic
903024524 1:20417946-20417968 TGGGGGAGCACAGAGGGAGTGGG + Intergenic
903480118 1:23646952-23646974 TGGGGAGGCACAGGGATTGGGGG - Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906671480 1:47658342-47658364 TGGGGGAGGACACAGCTTGTTGG + Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907547391 1:55274205-55274227 AGGTGGAGCACAGGGATTTTAGG + Intergenic
907911904 1:58834346-58834368 GAGGGAAGCACAGGGATTGTGGG + Intergenic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909209810 1:72808753-72808775 AGGGGGAAGAAAGTGATTGTGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910476836 1:87616518-87616540 TGGGAGAGCAGAGTGATTATAGG + Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911019729 1:93374634-93374656 GGGGAGAGCACAGTTATTATGGG + Intergenic
911184260 1:94887665-94887687 TGGGGAAGCACTGTTTTTGTGGG - Intronic
911280722 1:95924724-95924746 TAGGTGACCACAGTGAGTGTAGG - Intergenic
911678920 1:100691832-100691854 TGGGTGAGGCCAGTGACTGTTGG - Intergenic
912391509 1:109306401-109306423 TGGGGCAGCACAGTGACACTCGG - Intronic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912899303 1:113630726-113630748 AGGGGGAGCACAGTGGCTGATGG - Intronic
912957228 1:114164079-114164101 TGGGGGAGCACATTCATTCTAGG + Intergenic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915972195 1:160362721-160362743 GGGGGGAGCCCAGTGGTTGGAGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918158331 1:181872570-181872592 TGGGGGGGCACAGTGGGAGTGGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919060441 1:192625326-192625348 TGGGGCAGAACAGTGAATGCAGG - Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919713319 1:200750118-200750140 GCGGGGAGCAGAGTGAATGTGGG + Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
921073513 1:211682005-211682027 GGGGGCAGCACAGTGATGGTAGG + Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
1063125037 10:3129748-3129770 TGGGGGAGCTCTGGGATGGTGGG + Intronic
1063858235 10:10278966-10278988 TGGAGCAGGACAGTGATTCTAGG - Intergenic
1064517821 10:16169510-16169532 TGGAGGACCACAGTGATGTTTGG + Intergenic
1064899145 10:20274795-20274817 TGGGGAAACACAGTGGTTTTGGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1067153351 10:43753946-43753968 TGGCGGAACACAGGGAGTGTGGG + Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069555898 10:69398489-69398511 TGGATGAGTACAGTGATTGGGGG + Intronic
1070584971 10:77757346-77757368 TGGCTGAGCACAGTGCTTCTTGG - Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1073127824 10:101162915-101162937 TGGGGAAGCACAGACATTGGAGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075837103 10:125463282-125463304 TGGGGCAGCACTGGGATTCTCGG - Intergenic
1075982778 10:126755688-126755710 TGGGTGAGGACAGTGACTGCTGG - Intergenic
1077268341 11:1663421-1663443 TCGGGGAGCACAGAGACTGAGGG - Intergenic
1077272538 11:1688197-1688219 TCGGGGAGCACAGAGACTGAGGG + Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1077917068 11:6618336-6618358 TGGGGGAGTACAGTGAGGGGTGG + Intronic
1078019335 11:7642228-7642250 AGAGGAAGCACAGTGACTGTAGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079468936 11:20759820-20759842 TGGGGGAGCAGAGTGTTCCTGGG + Intronic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1083267815 11:61555104-61555126 GGGGGGAGCACTGTGGCTGTGGG - Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1084403361 11:68957284-68957306 TGAGGGGCCACAGTGATTGAGGG - Intergenic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087498275 11:98917961-98917983 GGGGGAAGCACAGTGATCATGGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090439474 11:126713877-126713899 AGGGGGAGCACAGTGCTTGGAGG + Intronic
1091164034 11:133455127-133455149 TGTGGGAGAAGAGTGATTTTCGG - Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1095088929 12:38086420-38086442 TGGAGGAGCAGAGTGAGGGTAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1097614368 12:61865806-61865828 TGGGGGATCATAGAAATTGTGGG - Intronic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1102495907 12:113319535-113319557 TGGTGGAGCCCAGTGAGAGTTGG - Intronic
1102592062 12:113963988-113964010 TGTGGGAGCACAGTGAGGGTTGG - Intronic
1104655569 12:130571809-130571831 TGGGGCAGCAGAGTGAGTGAAGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108717984 13:53100695-53100717 TGGGGGAGCTCAGGGCTTCTTGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112300566 13:98225928-98225950 TTGGGGAGGTCAGTGATGGTTGG + Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113366649 13:109682818-109682840 GGTGGGAGCACTGTGATGGTGGG - Intergenic
1113585481 13:111461577-111461599 TGGGCGAGCACTGTGTCTGTGGG + Intergenic
1113720403 13:112551883-112551905 TGGGGGGGCAGAGTGGTTTTGGG + Intronic
1115078236 14:29416963-29416985 TGGAGGAACACAATTATTGTGGG + Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116072066 14:40059670-40059692 TGAGTCAGCACAGTGAGTGTGGG - Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116583586 14:46674299-46674321 GAGGGAAGCACAGTGATTGAAGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117912774 14:60650101-60650123 GGGGGGAGGACAGTGGTAGTTGG - Intronic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119709594 14:76812444-76812466 TGGGGGTGCAGAGAAATTGTGGG - Intronic
1119911669 14:78355275-78355297 TGAGGGAGCACAGTGAGAGATGG + Intronic
1121600197 14:95197725-95197747 TGCAGGAGCACGGTCATTGTTGG + Intronic
1124568057 15:30834336-30834358 TGGGGGAGGAAAGTGAATCTCGG - Intergenic
1126486648 15:49188430-49188452 TGGAGGAGTACAGTGATTATGGG - Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127132527 15:55882364-55882386 TGGGAGAGCTCAGTGACAGTGGG + Intronic
1127899087 15:63328039-63328061 TGGGTGATCACTGTGATTCTTGG - Intronic
1128234790 15:66060009-66060031 TGGGGGAGCATTAGGATTGTGGG + Intronic
1128712115 15:69879737-69879759 TGAGGGAGGACAATGTTTGTTGG - Intergenic
1130099481 15:80881600-80881622 TGTGGGAGCACAGCGAGTGGCGG + Intronic
1130939808 15:88498029-88498051 TGGGGGAGCACAGAGACCTTGGG - Intergenic
1132203307 15:99969782-99969804 GGGGGGAGGTCAGTGATGGTGGG + Intergenic
1133852251 16:9516421-9516443 TGGGGGTGATCAGTGCTTGTTGG + Intergenic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1134537354 16:15036754-15036776 TGAAGGAGAGCAGTGATTGTGGG + Exonic
1135424785 16:22326992-22327014 CGGGGGAGCAGAGTGCTTGCTGG + Intronic
1138000266 16:53271146-53271168 GGATGGAGCATAGTGATTGTGGG - Intronic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139239399 16:65375469-65375491 TGGGTGAGCACAGCTAGTGTTGG - Intergenic
1141453111 16:84118903-84118925 TGGGGTAGAACAGTGATTGCAGG + Intergenic
1142849056 17:2695590-2695612 TGGGGGAGCACAGCTATCCTGGG + Intronic
1143042364 17:4048040-4048062 CGGGGAAGCACAGTGCTTATGGG + Intronic
1143268324 17:5657378-5657400 TGGCGGAGCAAGGTGATTGCTGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144098784 17:11925513-11925535 TGGGTCAGCACAGTGCTTGAAGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145803544 17:27708555-27708577 TGGGGGAACACAGTAATTTAAGG + Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146121418 17:30198895-30198917 TTGGGGAGCAGAGTAATTGCTGG + Intronic
1146947115 17:36881101-36881123 TGGGGGTGCACAGTGAGGTTGGG - Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1152805992 17:82356592-82356614 TGGGGCAGCACAGCCATTGTGGG - Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1163386310 19:17002194-17002216 TGAGGGAGCAGCGTGATGGTTGG + Intronic
1164524572 19:29003931-29003953 TGGGGGAGCACAGAGAAAGGGGG - Intergenic
1166623919 19:44332318-44332340 TGGGGCAGCACACTGATTGTGGG + Intronic
1167637398 19:50662705-50662727 TGGGGGAGGACAGGGATTTAGGG + Intronic
1167852125 19:52210284-52210306 TGAAGGAGCACAGTCATTCTAGG + Intronic
925555727 2:5129952-5129974 TGGGAGAGCCCTGTGATTCTAGG - Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928175059 2:29027886-29027908 TGGTGGAGCACAGTGAGTGAGGG + Intronic
928450105 2:31371067-31371089 TGGGATAGCACAATGAATGTGGG - Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
931208276 2:60168558-60168580 TGTGGGAGCACAGGGCATGTTGG - Intergenic
934095503 2:88598926-88598948 TGGGGGAGAAGAGTGAGAGTGGG + Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935549206 2:104433990-104434012 TGAGGGAGTATAGTAATTGTTGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942541752 2:177022305-177022327 TGGGGCAGCAGAGAGATAGTGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943698222 2:190959678-190959700 TTGGTGAGGACAGTGATTGCTGG + Intronic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
946817688 2:223595796-223595818 TGGGGGAAAACATTGAATGTAGG - Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172130212 20:32650323-32650345 CTGGGGAGCAGAATGATTGTGGG + Intergenic
1173365384 20:42380369-42380391 TGAGGCAGGACAGTGAGTGTGGG - Intronic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174495343 20:50937532-50937554 GGAGGGAGCACTGGGATTGTGGG + Intronic
1176386926 21:6142774-6142796 TGGGCGAGCACTGTGATGGAGGG + Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1178111805 21:29376547-29376569 TGGGGGTGCTCACTGATGGTGGG + Intronic
1179736547 21:43395478-43395500 TGGGCGAGCACTGTGATGGAGGG - Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181841400 22:25665192-25665214 TTGTGGAGCACAGTGATAGGCGG - Intronic
1182866347 22:33607648-33607670 TGGAGGAGGACAGTGAGTCTGGG + Intronic
1183257945 22:36775154-36775176 TGGGGCAGCACAGTAACTTTGGG + Intronic
1185149823 22:49157857-49157879 TGTGGGAGAACGGTGAGTGTCGG + Intergenic
1185219995 22:49624415-49624437 GGGGAGAGCACAGTGATGCTCGG + Exonic
949862400 3:8518147-8518169 TGGGGGAGCTCTGTGCATGTTGG - Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951467725 3:23020276-23020298 TGGGGGAGCACAATGGGGGTTGG + Intergenic
952307296 3:32157501-32157523 TGGAGGGACACAGTGATTGCAGG - Intronic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
954137361 3:48588193-48588215 TAGGCGAGGACAGTGATGGTGGG - Intronic
954249083 3:49354499-49354521 TGAGGGAGCAAAGTGCTTTTGGG + Intergenic
955868442 3:63410832-63410854 TTGAGGAGGACAGTGATGGTTGG + Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959647760 3:108722685-108722707 TCAGGCAGCCCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960015921 3:112887711-112887733 TGGTGGAGAACATTGATGGTGGG - Intergenic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
962282714 3:134064372-134064394 GTGGGGAGCACAGTCATGGTGGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963445264 3:145397113-145397135 TGGGGGAGCACATGGATATTTGG - Intergenic
963515360 3:146301557-146301579 TGGGGTAGCACAGTGGCTATGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963806078 3:149724389-149724411 GGGGGGATCACATTGATTCTTGG - Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964476274 3:157100464-157100486 TGGGGGACTACAGTGGCTGTGGG + Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965757732 3:172041539-172041561 TGGGGAGGCACGGTGGTTGTGGG + Intronic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966540821 3:181088045-181088067 TGGGGGAGAACTGTGATTTCAGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968927183 4:3555710-3555732 TGTGGGTGCACAGTGATGGCCGG + Intergenic
969788678 4:9477133-9477155 TGGGGGGGCCCTGTGATTGCTGG - Intergenic
970965389 4:21922277-21922299 TGGAGGAAGACAGTGCTTGTTGG - Intronic
971585371 4:28399425-28399447 TGGGGGTGCACATTAAATGTTGG - Intronic
971616800 4:28800915-28800937 TTGGAGATCACAGTGATAGTAGG - Intergenic
971825879 4:31621997-31622019 TGGGGGAGCAGAATGCTGGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975818096 4:78240775-78240797 TTGGGGAGCACAGTCATTTAAGG + Intronic
976082940 4:81376033-81376055 GGGGAGGGCACAGCGATTGTGGG - Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979111271 4:116761152-116761174 AGGGGAAGCACGGTGATTGTGGG + Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982339723 4:154284589-154284611 AGGGTGAGCATGGTGATTGTGGG + Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983835368 4:172377635-172377657 TGGGGGAGCTCGGTCATGGTGGG + Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
991282247 5:64928182-64928204 TGAGGAAACACAGTGAATGTGGG - Intronic
992794535 5:80243915-80243937 TGGGGGAGCACAGAAAGTGGGGG + Intronic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
995676575 5:114669253-114669275 TGAGGCAGCACAGTGTTTGGGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
997585852 5:135042844-135042866 TGGAGGAGCATGGTGATTCTGGG - Intronic
998336015 5:141372646-141372668 TGAGGCAGCACACGGATTGTAGG - Exonic
999166072 5:149550768-149550790 TGGGGGTGCACGGTGGTGGTGGG + Intronic
1000022021 5:157326480-157326502 TGGTGCAGCACAGAGTTTGTGGG - Intronic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1000456380 5:161454610-161454632 TGGAGTAGCACAGTAATTGGTGG - Intronic
1001980601 5:176035088-176035110 TGGGGAACCACAGTGGGTGTGGG + Intergenic
1002236858 5:177808977-177808999 TGGGGAACCACAGTGGGTGTGGG - Intergenic
1002381256 5:178831545-178831567 TGGGGAACCACAGTGGGTGTGGG + Intergenic
1002783021 6:381160-381182 TGGGGTTGCACAGTGCATGTTGG + Intergenic
1004020008 6:11768854-11768876 TGGGAGAGCACAGAGATTCGTGG - Intronic
1004989971 6:21125865-21125887 CGGGGAAGCACAGAGATTGTGGG - Intronic
1004996819 6:21201322-21201344 TGTGGAAGCACAGTGATTCCAGG + Intronic
1005279854 6:24261941-24261963 GGGGGGTGGACAGTGATTGCTGG - Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1011535740 6:88374212-88374234 TGGAGGGGCACAGTGAATGCTGG + Intergenic
1011684774 6:89815438-89815460 TGGGGAAGCACAGACATTCTGGG - Intronic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1014107103 6:117578435-117578457 TGGCAGAGCACAGTGATGGAAGG + Intronic
1014253392 6:119138162-119138184 TGGGGGAGTGCAGTTGTTGTAGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015890759 6:137967777-137967799 TGGGGCATCAGAGTGATGGTGGG - Intergenic
1015890770 6:137967812-137967834 TGGGACAGCAGAGTGATGGTGGG - Intergenic
1015890787 6:137967882-137967904 TGGGACAGCAGAGTGATGGTGGG - Intergenic
1015890810 6:137967983-137968005 TGGGACAGCAGAGTGATCGTGGG - Intergenic
1015890822 6:137968050-137968072 TGGGAGATCAAAGTGATGGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1020831175 7:13097263-13097285 TAGGGGAGAAAAGTGAGTGTGGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1026399637 7:69996550-69996572 GTGGGGAGGACAGTGTTTGTAGG - Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028813020 7:95110367-95110389 TGGGGGAGCACAGTTTCTTTAGG + Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG + Exonic
1038524576 8:28262003-28262025 TGGGGGAGCAGAGAGATTTCAGG + Intergenic
1041872200 8:62648032-62648054 TGAGGGACCAAAGTGATTCTCGG + Intronic
1041901335 8:62986410-62986432 TGGGGCAGTCCAGTGATAGTGGG - Intronic
1042192261 8:66198895-66198917 GGGTGGGGAACAGTGATTGTAGG - Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043603396 8:81969388-81969410 TAGTGGAGCACAGTGAGTGATGG - Intergenic
1043973099 8:86554642-86554664 TGGGGGAGGACAGAGCTTATAGG + Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045006622 8:97921721-97921743 TGAGGGAGCACAGTGGTGGGTGG + Intronic
1045624732 8:104030505-104030527 TGGGGGAGCACAGGTCATGTAGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047225459 8:122952537-122952559 GCGGGCAGCACAGTGATGGTCGG - Exonic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048873312 8:138816365-138816387 TGGGGCAGCACAGTGATGTCAGG - Intronic
1049172763 8:141172143-141172165 TGGGTGTGCATAGTGACTGTGGG + Intronic
1049172774 8:141172225-141172247 TGGGTGTGCACAGTGTCTGTGGG + Intronic
1049693555 8:143973131-143973153 TGGGGGCGCTCAGGGCTTGTCGG - Intronic
1049879043 8:145049523-145049545 AGGGGCTGCACAGTAATTGTAGG - Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051594347 9:18809402-18809424 TGCTGGAGCACTGTGATTGATGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1053802108 9:41771120-41771142 TGTGGGTGCACAGTGATGGCGGG + Intergenic
1054143162 9:61544169-61544191 TGTGGGTGCACAGTGATGGCGGG - Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054462871 9:65475050-65475072 TGTGGGTGCACAGTGATGGCAGG - Intergenic
1054647979 9:67605311-67605333 TGTGGGTGCACAGTGATGGCGGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1058086284 9:100752028-100752050 AGGGGTTGCACAGTGATTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060866141 9:126999266-126999288 TGGGGGAGGACGCTGATAGTGGG - Intronic
1061801968 9:133117681-133117703 TCTGGGAACACAGTGATTCTGGG + Intronic
1061849692 9:133407131-133407153 TGGGAGGGCTCAGTCATTGTGGG - Intronic
1062252044 9:135603188-135603210 AGGGGGAGCACAGTGGTTAGGGG - Intergenic
1062375610 9:136260539-136260561 TGGGGTGGCACCGTGATTCTCGG - Intergenic
1062441031 9:136569282-136569304 TGGGGGAGCCCAGAGCATGTGGG + Intergenic
1202630032 M:8851-8873 TGAGCGGGCACAGTGATTATAGG + Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185574689 X:1162124-1162146 TGGGGGTGTAGAGTGAATGTGGG + Intergenic
1185631715 X:1520137-1520159 TTGGGGACCACAGAGATTATTGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189606318 X:42681927-42681949 TGGGGCAGTACAGTGGTGGTGGG + Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190036378 X:47028771-47028793 TGTTGGAACACAGTGCTTGTGGG - Intronic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192695442 X:73410313-73410335 TGGGGGAGCTAAGCGAGTGTTGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1196871372 X:120116137-120116159 GGGGGGTGCACAGTGAGGGTGGG + Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197887222 X:131231126-131231148 TGGGAGAGCGGAGTGATTGGAGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199893930 X:152114820-152114842 GGAGGGAGCACAGTGTCTGTGGG - Intergenic
1201984814 Y:19954227-19954249 TGGGTGCCCATAGTGATTGTAGG + Intergenic
1202175457 Y:22094867-22094889 TGTGGGAGTATAGTGAGTGTAGG - Intronic
1202215905 Y:22491516-22491538 TGTGGGAGTATAGTGAGTGTAGG + Intronic