ID: 1115661403

View in Genome Browser
Species Human (GRCh38)
Location 14:35498281-35498303
Sequence TTTCCAATGCTGAAAGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115661403_1115661408 5 Left 1115661403 14:35498281-35498303 CCCCCAACTTTCAGCATTGGAAA No data
Right 1115661408 14:35498309-35498331 CCCAGACAAAAAAATCAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115661403 Original CRISPR TTTCCAATGCTGAAAGTTGG GGG (reversed) Intergenic
No off target data available for this crispr