ID: 1115661408

View in Genome Browser
Species Human (GRCh38)
Location 14:35498309-35498331
Sequence CCCAGACAAAAAAATCAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115661399_1115661408 28 Left 1115661399 14:35498258-35498280 CCAACACAATAATACCTGGAGAC No data
Right 1115661408 14:35498309-35498331 CCCAGACAAAAAAATCAATAAGG No data
1115661405_1115661408 3 Left 1115661405 14:35498283-35498305 CCCAACTTTCAGCATTGGAAAGA No data
Right 1115661408 14:35498309-35498331 CCCAGACAAAAAAATCAATAAGG No data
1115661402_1115661408 6 Left 1115661402 14:35498280-35498302 CCCCCCAACTTTCAGCATTGGAA No data
Right 1115661408 14:35498309-35498331 CCCAGACAAAAAAATCAATAAGG No data
1115661403_1115661408 5 Left 1115661403 14:35498281-35498303 CCCCCAACTTTCAGCATTGGAAA No data
Right 1115661408 14:35498309-35498331 CCCAGACAAAAAAATCAATAAGG No data
1115661398_1115661408 29 Left 1115661398 14:35498257-35498279 CCCAACACAATAATACCTGGAGA No data
Right 1115661408 14:35498309-35498331 CCCAGACAAAAAAATCAATAAGG No data
1115661404_1115661408 4 Left 1115661404 14:35498282-35498304 CCCCAACTTTCAGCATTGGAAAG No data
Right 1115661408 14:35498309-35498331 CCCAGACAAAAAAATCAATAAGG No data
1115661406_1115661408 2 Left 1115661406 14:35498284-35498306 CCAACTTTCAGCATTGGAAAGAT No data
Right 1115661408 14:35498309-35498331 CCCAGACAAAAAAATCAATAAGG No data
1115661400_1115661408 14 Left 1115661400 14:35498272-35498294 CCTGGAGACCCCCCAACTTTCAG No data
Right 1115661408 14:35498309-35498331 CCCAGACAAAAAAATCAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115661408 Original CRISPR CCCAGACAAAAAAATCAATA AGG Intergenic
No off target data available for this crispr