ID: 1115663236

View in Genome Browser
Species Human (GRCh38)
Location 14:35518459-35518481
Sequence AAATAAGTAAATAAGAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115663236_1115663239 5 Left 1115663236 14:35518459-35518481 CCTAGTTTCTTATTTACTTATTT No data
Right 1115663239 14:35518487-35518509 GGGTCTTGCTCCCATCACCCAGG No data
1115663236_1115663240 9 Left 1115663236 14:35518459-35518481 CCTAGTTTCTTATTTACTTATTT No data
Right 1115663240 14:35518491-35518513 CTTGCTCCCATCACCCAGGCCGG No data
1115663236_1115663243 19 Left 1115663236 14:35518459-35518481 CCTAGTTTCTTATTTACTTATTT No data
Right 1115663243 14:35518501-35518523 TCACCCAGGCCGGAGTGCAGTGG 0: 685
1: 84696
2: 175184
3: 206160
4: 178511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115663236 Original CRISPR AAATAAGTAAATAAGAAACT AGG (reversed) Intergenic
No off target data available for this crispr