ID: 1115664494

View in Genome Browser
Species Human (GRCh38)
Location 14:35533538-35533560
Sequence TCCGCCCGCCGGTATCGATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115664494_1115664502 11 Left 1115664494 14:35533538-35533560 CCCGATCGATACCGGCGGGCGGA No data
Right 1115664502 14:35533572-35533594 CGCCGACAGCAGCCACAGGGCGG No data
1115664494_1115664505 28 Left 1115664494 14:35533538-35533560 CCCGATCGATACCGGCGGGCGGA No data
Right 1115664505 14:35533589-35533611 GGGCGGTGCAGTCAGCTGTCCGG No data
1115664494_1115664500 8 Left 1115664494 14:35533538-35533560 CCCGATCGATACCGGCGGGCGGA No data
Right 1115664500 14:35533569-35533591 CGCCGCCGACAGCAGCCACAGGG No data
1115664494_1115664499 7 Left 1115664494 14:35533538-35533560 CCCGATCGATACCGGCGGGCGGA No data
Right 1115664499 14:35533568-35533590 CCGCCGCCGACAGCAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115664494 Original CRISPR TCCGCCCGCCGGTATCGATC GGG (reversed) Intergenic