ID: 1115667357

View in Genome Browser
Species Human (GRCh38)
Location 14:35566199-35566221
Sequence GTAAGAAACAAGTGCAGCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115667355_1115667357 30 Left 1115667355 14:35566146-35566168 CCTAGCTGACAAAATCAGAAGTT 0: 1
1: 0
2: 1
3: 28
4: 267
Right 1115667357 14:35566199-35566221 GTAAGAAACAAGTGCAGCGAAGG 0: 1
1: 0
2: 0
3: 11
4: 124
1115667356_1115667357 -9 Left 1115667356 14:35566185-35566207 CCAGTACAAGTAATGTAAGAAAC 0: 1
1: 0
2: 0
3: 16
4: 159
Right 1115667357 14:35566199-35566221 GTAAGAAACAAGTGCAGCGAAGG 0: 1
1: 0
2: 0
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115667357 Original CRISPR GTAAGAAACAAGTGCAGCGA AGG Intronic
903846973 1:26284486-26284508 GCAAGAAAGAAGGGCAACGACGG + Intronic
904433640 1:30480300-30480322 GAAGGAAACAAGTGAAGCCAAGG + Intergenic
905803217 1:40859124-40859146 GTAAGGAACAAATTCAGAGATGG - Intergenic
906558534 1:46735524-46735546 GTTAGAAATAAGGGCAGGGAAGG + Intergenic
909445377 1:75743213-75743235 GTATGAGACAGGTGCAGAGAGGG + Intronic
913647868 1:120878023-120878045 GTAATAGACATGTGCAGCCAAGG + Intergenic
913701849 1:121381879-121381901 GGAAGAAACAGGTCCAGAGAAGG + Intronic
914042408 1:144062348-144062370 GGAAGAAACAGGTCCAGAGAAGG + Intergenic
914078760 1:144384825-144384847 GTAATAGACATGTGCAGCCAAGG - Intergenic
914100419 1:144581677-144581699 GTAATAGACATGTGCAGCCAAGG + Intergenic
914135680 1:144898140-144898162 GGAAGAAACAGGTCCAGAGAAGG - Intronic
914638064 1:149572549-149572571 GTAATAGACATGTGCAGCCAAGG + Intergenic
916313263 1:163419805-163419827 GGAAGAAAGAACTGCAGGGAAGG - Intergenic
920489272 1:206400599-206400621 GGAAGAAACAGGTCCAGAGAAGG + Intronic
921386131 1:214571846-214571868 GGAAGAAATCAGTGCATCGAGGG - Intergenic
922174126 1:223181840-223181862 GCCAGAAACAGGTGCAGAGAAGG + Intergenic
1064181432 10:13119700-13119722 GTAAGAAACAAGTGTTGGTATGG - Intronic
1071208544 10:83312055-83312077 GTAAGAACCAGGTGCAGGGTTGG - Intergenic
1074548714 10:114423348-114423370 GGAAGAAAAAAGTGCAACTAGGG - Intergenic
1075067561 10:119299668-119299690 GCAAGAAGGAAGTGCAGAGAAGG + Intronic
1080125058 11:28723324-28723346 GTAATAGAAAAGTGCAGGGAAGG - Intergenic
1082875729 11:57986387-57986409 GTAAGAATGAAGTGCAGAGAAGG + Intergenic
1084528790 11:69714452-69714474 GTAAGAAACAAGTGCAGGCCAGG + Intergenic
1084710748 11:70842504-70842526 GAAAGGGACAAGTGCAGAGAGGG - Intronic
1089319509 11:117615483-117615505 ATAAGAAGCAAGTGCAGGGAGGG + Intronic
1091639696 12:2226704-2226726 TTAAGACCCAAGTGCAGTGAAGG - Intronic
1093239231 12:16648948-16648970 GCAAAAAACAAGTGCAACAAGGG + Intergenic
1099929296 12:89055093-89055115 GTAAGCAACAGGTGCAACGCGGG + Intergenic
1102868381 12:116392653-116392675 GTAAGAAACAAATTCAGGGCCGG + Intergenic
1107655606 13:42589721-42589743 GTAATCAGCAAGTGCAGAGAGGG + Intronic
1110576986 13:77068996-77069018 CTAAGAAACAAGTAAAGCTAAGG + Intronic
1113504153 13:110801669-110801691 CTGAGAAACAAATGCAGCAAGGG - Intergenic
1115667357 14:35566199-35566221 GTAAGAAACAAGTGCAGCGAAGG + Intronic
1115772954 14:36685716-36685738 GTCAGAAAGCAGTGCAGGGAGGG - Intronic
1117575135 14:57090364-57090386 GCAAGAAACAAGAGCAGCTCCGG + Intergenic
1117825862 14:59702957-59702979 GGAAGAAACAACTGCAGTAAAGG - Intronic
1121185736 14:91966822-91966844 GTAAAAAACTATGGCAGCGAAGG + Exonic
1121457228 14:94046195-94046217 TGAAGAAACAAGTCCAGAGAGGG - Exonic
1130105566 15:80926103-80926125 GTAAGAAAGAAATGCAACCAAGG - Intronic
1132838746 16:1967918-1967940 GAGAGAAACAAGTGCAGCCTTGG + Intronic
1133365550 16:5206311-5206333 TTAAGAAAAAAGTGCTTCGAAGG + Intergenic
1134483152 16:14635659-14635681 GTCAGAAACCAGTGGAGCAAAGG - Intronic
1135932799 16:26753466-26753488 TTAAGATCCAAGTGCAGGGATGG + Intergenic
1137619749 16:49868444-49868466 GCAAGAGCCAAGAGCAGCGAGGG - Intergenic
1137913143 16:52399312-52399334 GAAAGACACAAGGGCAGGGAAGG - Intergenic
1141255562 16:82398968-82398990 GCAAGACAAAAGTGCAGTGAAGG - Intergenic
1144156521 17:12509105-12509127 GAAAGAAAGAAGTGGAGGGAAGG + Intergenic
1144833942 17:18147176-18147198 GGAAGAAACAGGTTCAGAGAGGG - Intronic
1146139700 17:30354989-30355011 GAAAGAAACAGGTTCAGTGAAGG + Intergenic
1149895936 17:60428362-60428384 GGAAGAAACAGATGCAGAGAGGG - Intronic
1149986658 17:61352787-61352809 GTAAGAGAAAAGGGCAGAGATGG + Intronic
1150042653 17:61880344-61880366 GTTAGAAATAAGTGCAGTGTAGG - Intronic
1151699486 17:75735699-75735721 GTAAGAAATAAGTCCAGGCAAGG - Intronic
1153892414 18:9530365-9530387 GAAAGGAAAAACTGCAGCGATGG + Intronic
1156553329 18:38041349-38041371 GTCAGCAACAAGGACAGCGAGGG + Intergenic
1160679594 19:406646-406668 GGAAGACACACGTGCAGTGAAGG + Exonic
1166560597 19:43730051-43730073 GTGAGAAACAACTGAAGTGAGGG - Exonic
1168319788 19:55501857-55501879 GTGAGAAACAGGAGCAGAGATGG - Intronic
925191540 2:1888499-1888521 GTAAGACACTAGTGCTTCGATGG + Intronic
926737550 2:16084879-16084901 GTGTGAAACAAGGGCAGCTAGGG - Intergenic
926930320 2:18031543-18031565 GGAAGGAAAAAGTGCAGAGAGGG - Intronic
929912898 2:46106910-46106932 GTATGAAACAACTTCATCGAAGG - Intronic
930274523 2:49296068-49296090 GTAGGAAACCTGTGCAGCGGAGG + Intergenic
931964221 2:67515678-67515700 GCAAGAAAACAGTGCAGTGATGG + Intergenic
933610987 2:84435086-84435108 GTAAGAAACAAGTCTGGAGAGGG - Intronic
935188882 2:100759792-100759814 CAAAGAAACAAGTGCTGCCAAGG - Intergenic
939099242 2:137876180-137876202 GTAAGAAATAAGAGCTGCAATGG + Intergenic
940042399 2:149374166-149374188 GAAAGAAACCAGGGCAGGGAAGG + Intronic
941605659 2:167593712-167593734 GTGAGGAACAAGGGCAGCCAAGG + Intergenic
941872817 2:170403504-170403526 GTAAGAAACTAGTGGACCCAAGG + Intronic
942996468 2:182266906-182266928 ATCAGAAACAAGTCCAGAGATGG - Intronic
945838394 2:214859322-214859344 GTAAGTAGCAAGTGCAGGGATGG + Intergenic
945838540 2:214860934-214860956 GTAAGTAGCAAGTGCAGGGATGG + Intergenic
1170030620 20:11940162-11940184 GTAAGAGACAACTGCAGTGAGGG - Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1172962832 20:38810559-38810581 GAGAGAAACAAGTGCAGAGGTGG - Intronic
1173016687 20:39232301-39232323 GCAAGAAAAAAGTGCAGGGCTGG + Intergenic
1173040916 20:39461398-39461420 GTAAGAACCAACTGAAGCAATGG - Intergenic
1175314864 20:58040160-58040182 GGAAGAAACAAGGGCAGAGGCGG - Intergenic
1175548984 20:59803936-59803958 CTGAGAAACAGGTGCAGGGACGG - Intronic
1183303587 22:37070432-37070454 GTAAGAGACAAGGGCAGGGAAGG - Intronic
959807622 3:110576047-110576069 GAAAGAAACAAGTAGAGAGATGG + Intergenic
960314759 3:116162961-116162983 GTAAGCAACAGGTCCAGGGATGG - Intronic
960925523 3:122792326-122792348 GTCAGAAAAAAGTGCAGGAAGGG + Intronic
961816548 3:129553576-129553598 GAAAGAAACCATTGCAGCTAAGG - Intergenic
964257556 3:154794345-154794367 GTAAGAATCAATTGCACCTAAGG - Intergenic
970133945 4:12901646-12901668 GAAAGAAACAAGAGAAGGGAAGG - Intergenic
976077142 4:81312534-81312556 GCAAGAAGCAAGGGCAGCGGTGG + Intergenic
976238105 4:82922269-82922291 CTAAGAAAGAAGTACAGCAACGG - Intronic
977243811 4:94605329-94605351 GTAATGAACAAGTGCAGAGATGG + Intronic
981406487 4:144375757-144375779 GTAAGAAAGAAGTGAGGCAAGGG + Intergenic
981901521 4:149870638-149870660 GTAAGAAAGAAGAGCAGCATGGG - Intergenic
984076965 4:175195303-175195325 TTAAGAAACAAGAGCAACCAGGG - Intergenic
984955378 4:185040262-185040284 TCAAGAATCAAGAGCAGCGATGG - Intergenic
986809555 5:11341240-11341262 GTCAGAAACAAGATCAGTGAAGG + Intronic
986847819 5:11776171-11776193 GTAGGAAACAAATACAGCTAGGG + Intronic
989979129 5:50621424-50621446 GTAATAAACATGTGCAGCCAAGG + Intergenic
993232404 5:85252560-85252582 GTAAGGAACAAGTACAGCATAGG + Intergenic
995341761 5:111068961-111068983 GTTAGAATCAGGTGCAGGGAAGG - Intergenic
995630815 5:114129966-114129988 GTTAGAAACAAGAGTAGAGATGG - Intergenic
998420216 5:141978445-141978467 CTCAGAAAAAAGTGCAGAGAAGG + Exonic
998455721 5:142271277-142271299 GAAAGAAAGAAGTGGAGGGAAGG + Intergenic
998956503 5:147444027-147444049 ATAGGAAACAGGTGCAGAGAAGG + Intronic
1002834810 6:857143-857165 CTAAGAAAAAAATGCAGCGATGG - Intergenic
1004884003 6:20034761-20034783 GGAAGAAAAAAGTGTAGCCAAGG - Intergenic
1005814636 6:29540814-29540836 CTAGGTAACAAGTGCAGGGAGGG - Intergenic
1016610514 6:145983859-145983881 GTAAGATACAAGAGTAGCTAAGG + Intergenic
1019875274 7:3805230-3805252 GTAATAAATAAGTTCAGCAAGGG - Intronic
1021446682 7:20741668-20741690 GTAAGAAGCAAGGGCAGGTAGGG - Intronic
1021619340 7:22536187-22536209 GCAGGAATCAAGTGCAGCCATGG - Intronic
1022039542 7:26567118-26567140 GTAAGAATCAAGTGGAGATAAGG + Intergenic
1022829905 7:34055478-34055500 GTTAGAATCAAGTGCAGATAGGG + Intronic
1023462745 7:40418440-40418462 GTAATAAAAATGTGCAGTGAGGG - Intronic
1023926789 7:44675321-44675343 CTAAGAAAGAAGTGGAGCCAGGG - Intronic
1026135238 7:67654532-67654554 GCTAGAAACAAATGCAGAGAGGG - Intergenic
1027967537 7:85031668-85031690 ATAAGAAACAAGCCCAGCGAAGG - Intronic
1028002292 7:85514468-85514490 GTAATCAAAAAGTGCAGAGAGGG - Intergenic
1028371919 7:90101403-90101425 GCAGGAATCAAGTGCAGCCATGG + Intergenic
1030283831 7:107804510-107804532 GGAAGCAAGAAGTGCAGCAAAGG - Intergenic
1031162653 7:118186639-118186661 TTAGGAAACAAGTTCAGAGAAGG + Intronic
1036211327 8:6843540-6843562 GGAAGAAAGAAATGCAGCCAGGG - Intergenic
1038458102 8:27691732-27691754 GTAATGAAGAAGTGCAGAGAGGG - Intergenic
1041109787 8:54473418-54473440 CTAAAGAAGAAGTGCAGCGATGG - Intergenic
1041353928 8:56979654-56979676 GTAAGAAACAAGGCCTGAGAGGG + Intronic
1041856333 8:62459825-62459847 GTAAGAAATGAGTCCAGAGAGGG + Intronic
1045565325 8:103308896-103308918 GTAAGATACAAGTGCAGATGAGG - Intronic
1047349596 8:124061028-124061050 GTTAGAAACTATTGCAGGGAAGG + Intronic
1052978503 9:34429943-34429965 GTAAGAAACCAGTGGAACAAGGG - Intronic
1055104033 9:72493874-72493896 GTAAGAAACAACTGAAACAATGG - Intergenic
1056057242 9:82838944-82838966 GTAACAACCAAGGGCAGGGAAGG + Intergenic
1060458399 9:123823460-123823482 GTAAGAAATAAGGCCAGAGAAGG + Intronic
1186343226 X:8664788-8664810 GCAAGAAAGAAGAGCAGCCACGG + Intronic
1192028796 X:67486763-67486785 GTAAGAAATAAGAGGAGGGAGGG + Intergenic
1199065430 X:143411583-143411605 GTAAGAAACAAGGGAAAAGAAGG - Intergenic
1200411186 Y:2863285-2863307 GTGACAAACAAGTGAAGTGAAGG + Intronic
1202050718 Y:20777650-20777672 GTGACAAACAAGTGAAGGGAAGG + Intronic