ID: 1115669108

View in Genome Browser
Species Human (GRCh38)
Location 14:35588744-35588766
Sequence CTCTGGATATATACCCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 694
Summary {0: 1, 1: 15, 2: 134, 3: 220, 4: 324}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115669108 Original CRISPR CTCTGGATATATACCCAGTA GGG (reversed) Intronic
902027854 1:13397331-13397353 TTTTGGATATATATCCAGCAGGG + Intergenic
904106937 1:28092827-28092849 TTAGGGATATATACCCAGAAGGG - Intergenic
904922325 1:34018394-34018416 CTTAGGATATATTCCCAGGAGGG + Intronic
905966229 1:42098601-42098623 TTTTGGATATCTACCCAGAAGGG - Intergenic
906572168 1:46852118-46852140 CTTTGGGTATATACCCAGTAAGG - Intergenic
907607937 1:55838225-55838247 CTTTGGATATATACCAAGTCAGG + Intergenic
907687630 1:56628875-56628897 CTCTGAAGGTATTCCCAGTAAGG - Intronic
908528065 1:65007253-65007275 GTCTGGATATTTCTCCAGTATGG - Intergenic
908610677 1:65856680-65856702 CTTTGGGTATATACTCAGTAAGG + Intronic
908819783 1:68073396-68073418 CTCTGGGTATATACCAATAATGG + Intergenic
909058830 1:70854963-70854985 TTCTGGATATGTACCCAGAGTGG - Intronic
909245986 1:73285057-73285079 CTCTGGGTATATACCCAGTAAGG - Intergenic
909268153 1:73588766-73588788 CCTTTGGTATATACCCAGTAAGG + Intergenic
909987129 1:82174724-82174746 CTTTGGATACATATCAAGTAGGG - Intergenic
910387250 1:86698469-86698491 CTCTGGGTGGATACCCAATAGGG + Intergenic
910496761 1:87838315-87838337 CTTTGGGTATATACCCAGTAAGG - Intergenic
910600693 1:89029019-89029041 CTTTAGGTATATACCCAGTAAGG + Intergenic
910811941 1:91247084-91247106 CTTTGGGTATATACCTAGTAAGG + Intergenic
910816227 1:91293690-91293712 CTTTGGGTATATACCTAGTAAGG - Intronic
910941139 1:92535399-92535421 CTTTGGGTATATACCCAGTAAGG - Intronic
911136124 1:94442966-94442988 CTTTGGATGTATACCCAATAGGG + Intronic
911338761 1:96612230-96612252 CTTTGGGTATATACCCAGTAAGG + Intergenic
911724808 1:101232202-101232224 CTTTGGGTATATACCCAGTAAGG - Intergenic
912034228 1:105291151-105291173 CTTTGGATATATACCCAGTAAGG + Intergenic
912141853 1:106739886-106739908 CTTGAGGTATATACCCAGTAAGG - Intergenic
912190725 1:107337101-107337123 TTTTGGATATATACCCAGAATGG - Intronic
912743736 1:112226916-112226938 CTTTGGGTATATACCCAGTATGG - Intergenic
912926702 1:113919342-113919364 CTTTGAATATATGCCCAGAATGG - Intergenic
913373405 1:118125873-118125895 CTTTGGATAAATACCTAATAGGG + Intronic
915843298 1:159235235-159235257 CTTTGGGTATATACCCCGTAAGG + Intergenic
916301139 1:163275780-163275802 CTCAGGATATATAATAAGTAAGG + Intronic
916364784 1:164013419-164013441 TTTTAGATATATACCCAGAAAGG - Intergenic
916635748 1:166666810-166666832 CTTTGGGTATATACCCAGTAAGG - Intergenic
916857869 1:168769891-168769913 CTTTGGGTATATACTCAGTAAGG - Intergenic
917323648 1:173810001-173810023 CTTTGGGTATATACCCAGTAAGG - Intronic
917399769 1:174634524-174634546 ATTTGGGTATATACCCAGTAAGG - Intronic
917580392 1:176371429-176371451 CTTTGGATATACATCCAGTGAGG + Intergenic
918832044 1:189411135-189411157 CTTTGGGTATATACCCAGTAAGG + Intergenic
919290287 1:195621602-195621624 CTTTAGGTATATACCCAGTAAGG + Intergenic
919435603 1:197555845-197555867 CTTTGGCTATATACCCAATATGG - Intronic
920410110 1:205752592-205752614 TTCTGGGTATATATCCAGAAAGG - Intergenic
920642874 1:207770902-207770924 CTTTGGGTATATACCCAGTAAGG + Intronic
921270278 1:213462398-213462420 CTTTGGGTATATACCCATAATGG - Intergenic
922737140 1:227992811-227992833 CTCTGGATCTATACCCAGAGTGG - Intergenic
923066449 1:230521686-230521708 CTTTGGCTATATACCCAGTATGG + Intergenic
923794541 1:237141568-237141590 CTCTGGACATCTTCCCAGTTGGG - Intronic
923920772 1:238562107-238562129 CTCAGAATATTTCCCCAGTAGGG - Intergenic
924575216 1:245274729-245274751 CTTTGGGTATATACCCAGTAAGG + Intronic
924575229 1:245274824-245274846 CTTTGGGTATATACCCAGTAAGG + Intronic
924821986 1:247501947-247501969 CTCTGGTTTTATACCCACCAGGG + Intergenic
1062869361 10:886438-886460 CTTTGGATAAATACTCAGAAAGG - Intronic
1063175808 10:3550037-3550059 CTCTGGGTAGACACACAGTAGGG - Intergenic
1063250995 10:4274688-4274710 CTTTGGGTATATACCCAGTAAGG - Intergenic
1064975083 10:21105686-21105708 CTTTGGGTATATACCCAATAAGG + Intronic
1065296915 10:24284740-24284762 TTTTGGGTATATACCCAATAAGG + Intronic
1065561263 10:26966123-26966145 CTTTGGATATATACCCAGAAAGG - Intergenic
1065644239 10:27817837-27817859 CTTTAGGTATATATCCAGTAGGG + Intronic
1066784656 10:38990093-38990115 CCTTGGGTATATACCCAGTAAGG + Intergenic
1067050085 10:43010741-43010763 CTCTGGATATTTTCCTAGTTGGG - Intergenic
1067760028 10:49038099-49038121 TTTTGGTTATATACCCAGAAGGG - Intronic
1068050296 10:51941951-51941973 CTTTGGGTATATACCCAGTAAGG + Intronic
1068127734 10:52862259-52862281 CTTTGGGTATATACCCCGTAAGG + Intergenic
1068412494 10:56675203-56675225 CTTTGAGTATATACCCAGTATGG + Intergenic
1068457715 10:57280076-57280098 TACTGGGTATATACCCAGTTTGG - Intergenic
1069016564 10:63435945-63435967 CTCTAAATAAATACCCAATATGG + Intronic
1070265147 10:74894905-74894927 TTTTGGCTATATACCCAGAAGGG + Intronic
1071105892 10:82094482-82094504 CTTTGGGTAGATACCCAGCAGGG - Intronic
1071144905 10:82557140-82557162 CTCTGGGTATATACCCATAATGG + Intronic
1071463510 10:85920059-85920081 CTCTGGAGAAGTCCCCAGTAGGG - Intronic
1072384661 10:94912289-94912311 CTTTGGCTATATACCCAGTAAGG - Intergenic
1072976566 10:100063814-100063836 CACTGTTTATATACCCAGCAGGG - Intronic
1073821828 10:107273040-107273062 CTTTGGATATATACTCAGTAGGG + Intergenic
1075814101 10:125251195-125251217 CTTTGGGTATCTACCCAGTAAGG + Intergenic
1076069663 10:127477572-127477594 CTTTCGGTATATACCCAGTAGGG + Intergenic
1077449939 11:2634679-2634701 CTTTGGGTATATACCCAGTAAGG + Intronic
1077728924 11:4707079-4707101 CTTTGGATATATACTCAGAGTGG + Intronic
1077817792 11:5704132-5704154 CTTTGGGTATATACCCAGCAGGG - Intronic
1078825695 11:14928187-14928209 TTTTGGATATATACTCAGTAAGG + Intronic
1079357442 11:19741854-19741876 CTTTGGGTATATACCCAGAAGGG + Intronic
1079665688 11:23102735-23102757 CTTTGGGCATATACCCAGTATGG - Intergenic
1080985696 11:37461596-37461618 CTTTGGGTATATACCCTGTATGG + Intergenic
1082151084 11:48739512-48739534 CTTTGGGTATATACCCAGTACGG - Intergenic
1082618538 11:55393073-55393095 CTCTAAAAATATTCCCAGTAAGG - Intergenic
1082637875 11:55618717-55618739 CTTTGGGTATACACCCAATATGG + Intergenic
1082793226 11:57361789-57361811 CTTTGGGTATATACCCAGTAAGG + Intronic
1082917835 11:58457654-58457676 CTTTGGGTATATACTCAGCAAGG - Intergenic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1085275764 11:75298675-75298697 CTTTGGGTGTATACCCAGGAGGG - Intronic
1085567873 11:77531128-77531150 ATCTGGAAATACAGCCAGTAGGG - Intronic
1086504115 11:87485292-87485314 CTTTGGAGATATACCCCATAAGG - Intergenic
1086510343 11:87550527-87550549 CTTTGGGTATATACCCACTTTGG + Intergenic
1086513093 11:87581827-87581849 CTTTGGATATGTACTGAGTAGGG + Intergenic
1087085705 11:94216438-94216460 CTTTGAGTATATACCCAGTATGG + Intergenic
1087124505 11:94610348-94610370 CTTTGGATATATAGCCAGAGTGG + Intronic
1087201964 11:95354668-95354690 CTTTGGATAAATAACAAGTATGG + Intergenic
1087387144 11:97486033-97486055 CTTTTGGTATATACCCAGTATGG - Intergenic
1087694855 11:101364978-101365000 CTTTGGGTATATGCCCAGTAAGG + Intergenic
1088403850 11:109450251-109450273 CTTTGGGTACATACCCAGTAAGG - Intergenic
1088541133 11:110915022-110915044 CTTTGGAAATATACCCAGTTGGG - Intergenic
1088703379 11:112435144-112435166 CTTTGGGTATATACCCAGCAGGG - Intergenic
1088730288 11:112674935-112674957 CTCTGGATATATGCTCATAATGG - Intergenic
1091488000 12:908327-908349 CTCTTTATATTTACCAAGTAAGG - Intronic
1092303383 12:7274261-7274283 CTCTGGGTAGATACCCAGTAGGG + Intergenic
1092639410 12:10487298-10487320 CTTTGGGTATATACCCAGTAAGG - Intergenic
1093052910 12:14523795-14523817 CTTTGGATAAATACCCAGCAAGG - Intronic
1093064071 12:14638357-14638379 CTTTGGATAAATACTCAGCAGGG - Intronic
1093076617 12:14765455-14765477 CTCTGAGTATATACCCAGTATGG - Intergenic
1093604083 12:21068536-21068558 CTCTGGCTATATACCTAGTATGG + Intronic
1093606664 12:21098668-21098690 CTTTGGATAAATTCCCAGTAGGG + Intronic
1093965039 12:25315433-25315455 CTCTGGGTAGGTACCCAGTAGGG - Intergenic
1094362386 12:29643283-29643305 TTCTGGGTAGATACCCAGTGTGG - Intronic
1094690704 12:32765599-32765621 CTTTGGGTAGATACTCAGTAAGG + Intergenic
1094742108 12:33301715-33301737 CTTTGGGTATATACCCAGTAGGG + Intergenic
1094758583 12:33500836-33500858 TTCTGGATAAATTCCCAGAAGGG + Intergenic
1094812562 12:34153111-34153133 CTCTGGTTTTATACCCACTAGGG - Intergenic
1095217901 12:39571210-39571232 CTTTGCATATATTCCCAGTGGGG - Intronic
1095258986 12:40076653-40076675 CTTTGGGTATATACCCAGTAAGG + Intronic
1095519507 12:43045935-43045957 CTTTGGATATGTATCCAATAAGG - Intergenic
1095836352 12:46643526-46643548 CACTGGGTATATATCCAGTAAGG - Intergenic
1095846122 12:46746828-46746850 CTTCAGGTATATACCCAGTAAGG - Intergenic
1096028724 12:48391861-48391883 CTTTGGGTATATACTCAGTAAGG + Intergenic
1097579220 12:61433053-61433075 CTCTGAATATATCACCAGTATGG - Intergenic
1097634706 12:62108486-62108508 CTTTGGGTACATACCCAGTAAGG + Intronic
1098187624 12:67914611-67914633 CTCTGAATATATGGCCATTAGGG - Intergenic
1098765908 12:74488500-74488522 TTTTTGGTATATACCCAGTAAGG - Intergenic
1099398125 12:82167444-82167466 CTTTGAATATATACCCAGTAAGG - Intergenic
1099446375 12:82756786-82756808 ATCTGTATATACAGCCAGTAGGG - Intronic
1099500944 12:83413769-83413791 CTGTGGGTATATACCTAGTAAGG + Intergenic
1099506442 12:83482218-83482240 CTTTGGGTATATACCCAGAAAGG + Intergenic
1099618221 12:84966378-84966400 CTTTGGGTATATAATCAGTAGGG + Intergenic
1099892769 12:88610048-88610070 CTTTGGGTATATATCCAGTATGG - Intergenic
1099937963 12:89150701-89150723 CTTTGGGTAGATATCCAGTAGGG - Intergenic
1099991623 12:89728525-89728547 CTGTGGGTATATACCCAAAATGG - Intergenic
1100119601 12:91353555-91353577 ATCTGGCTATATTACCAGTACGG - Intergenic
1100173213 12:92000962-92000984 CTTTGGATAATTGCCCAGTAGGG - Intronic
1100549827 12:95636786-95636808 CTCTGGGTATATACCCATAATGG - Intergenic
1100763372 12:97834608-97834630 CTTAGAGTATATACCCAGTAAGG - Intergenic
1100771622 12:97929244-97929266 TTGTGGATCTATACCCAGCATGG + Intergenic
1100948521 12:99817514-99817536 TTTTGGATATGTACCCAGCAGGG + Intronic
1101040913 12:100754554-100754576 TTTTGGATATATACCCAGAGTGG - Intronic
1101459293 12:104873528-104873550 CTTTGGATACATACCCAAAAGGG + Intronic
1104147220 12:126046729-126046751 CTCTGGGTGTATACCCAGTAGGG - Intergenic
1104543747 12:129692479-129692501 CTTTGGGTATATACCCAGAATGG - Intronic
1104564335 12:129866760-129866782 CTTTGGATATATACCCAGAGTGG - Intronic
1104737757 12:131148709-131148731 CTTTGAGTATATACCCAATAAGG + Intergenic
1105442303 13:20425543-20425565 CTCTGCATGAATACCCAGGAAGG - Intronic
1106362139 13:29040462-29040484 CTCTGGGTAGATACCCAGTAGGG + Intronic
1106433157 13:29701514-29701536 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1106905229 13:34400838-34400860 CTTTGGATACATGCCCAGTAGGG - Intergenic
1107632146 13:42353276-42353298 CTTTGGAAATATACCCAGAAAGG + Intergenic
1108469010 13:50749437-50749459 CTCTGTGTAGATACCCAGTAGGG + Intronic
1108671570 13:52695206-52695228 CTGAGGATATATATCCAGTGGGG + Intronic
1108846520 13:54684980-54685002 TTCTGGATATTTACTCTGTAGGG + Intergenic
1109361988 13:61305106-61305128 CTTTGGGTATATACCCAGAAAGG - Intergenic
1109373213 13:61452368-61452390 TTCTGGTTATATATCCAGAAGGG - Intergenic
1109485604 13:63015293-63015315 CTCTGGGTGTATACACAGTAAGG + Intergenic
1109580106 13:64319324-64319346 CTTCAGATATATACCCAGTATGG + Intergenic
1109584477 13:64380630-64380652 CTTTGGATAAATACTCAGTAAGG + Intergenic
1109897043 13:68706407-68706429 CTTTGGATATATACCCAGTAAGG + Intergenic
1110013269 13:70365874-70365896 TTTTGGATATATACCCAACATGG - Intergenic
1111032366 13:82620006-82620028 TTCTGGATAGATACCCAGTAGGG - Intergenic
1111327682 13:86720731-86720753 CTTTGGGTATATACACAGTAAGG - Intergenic
1111348951 13:87000521-87000543 CTTTTCATAGATACCCAGTAGGG - Intergenic
1111433721 13:88179105-88179127 CTCTGTCTACATACCCAGTTAGG - Intergenic
1111776709 13:92672523-92672545 CTTTGAGTATATACCCAGTATGG - Intronic
1112713557 13:102158161-102158183 CTTTGGGTATATACCCAGTAAGG - Intronic
1114121497 14:19674806-19674828 CTTTGGGCATATACCCAGAAAGG + Intergenic
1115669108 14:35588744-35588766 CTCTGGATATATACCCAGTAGGG - Intronic
1115724982 14:36203936-36203958 TTTTGGATAAATACCCAGAATGG - Intergenic
1115936382 14:38557964-38557986 CTTTGGGCATATATCCAGTATGG - Intergenic
1116265261 14:42680271-42680293 ATTTGGATATATATCAAGTAAGG - Intergenic
1116281211 14:42910467-42910489 CTTTAGGTATATACCCAGTAAGG + Intergenic
1116631006 14:47333142-47333164 CTTTGCATATATAACCACTAGGG + Intronic
1116703690 14:48268299-48268321 TTTTGGATATATATCCAGCATGG + Intergenic
1117030392 14:51663254-51663276 CTTTGGGTATATACCCAGTAGGG - Intronic
1118394686 14:65325884-65325906 CTTTTAGTATATACCCAGTAGGG - Intergenic
1119077391 14:71655470-71655492 CTTTGAGTAGATACCCAGTAGGG + Intronic
1119973684 14:79001566-79001588 CTCTGGATCTATACCCCTTTGGG + Intronic
1120282965 14:82462900-82462922 CTTTGGGTATATGCCCAGAAGGG - Intergenic
1120318637 14:82930457-82930479 CTTTGGGTATATACTCAGTACGG - Intergenic
1120439900 14:84522588-84522610 TTCTGGACATATATCCAGTTTGG + Intergenic
1120742420 14:88122705-88122727 CTTTGGGTATATACCTAGTAAGG + Intergenic
1121062743 14:90931029-90931051 TTTTGGATATATACCCACAAGGG - Intronic
1121987558 14:98522677-98522699 CTTTGAATATGTACCCAGCAGGG + Intergenic
1123228705 15:17079186-17079208 CTTTGGGTATATACCCAGTAAGG - Intergenic
1123508190 15:20967220-20967242 CTTTGGATATATGCCCAGAAGGG + Intergenic
1123565410 15:21540967-21540989 CTTTGGATATATGCCCAGAAGGG + Intergenic
1123601675 15:21978257-21978279 CTTTGGATATATGCCCAGAAGGG + Intergenic
1124066647 15:26350515-26350537 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1124117681 15:26862577-26862599 CTTTAGATAGATACACAGTATGG - Intronic
1125456485 15:39865190-39865212 CTTTGGGTAGATACCTAGTAGGG - Intronic
1126233890 15:46359387-46359409 CTTTGGATATATACCCTATAAGG - Intergenic
1126839416 15:52702252-52702274 ATCTGGATATATACCTGATAAGG - Intronic
1127090824 15:55465246-55465268 CTCTAGATAGATACCCAGTAGGG - Intronic
1127369391 15:58323261-58323283 TTTTGGATATATACCCAGTAAGG + Intronic
1128368696 15:67023588-67023610 CTCTGGAAATTTATCAAGTATGG + Intergenic
1128408067 15:67364057-67364079 CTTTGGGTATATACCCAATAAGG + Intronic
1128926914 15:71664994-71665016 CTTTGGGTATATACCCAGTAAGG + Intronic
1130363918 15:83215673-83215695 CTTTGGGTATATACCCAGTAAGG + Intergenic
1130956966 15:88633922-88633944 ATTTGAATATATACCCAGCAGGG + Intergenic
1131273788 15:90963566-90963588 TTTTGGATATATACCCAGAGTGG + Intergenic
1202973782 15_KI270727v1_random:268057-268079 CTTTGGATATATGCCCAGAAGGG + Intergenic
1132754868 16:1478635-1478657 CTTTGGGCATACACCCAGTAAGG - Intergenic
1134753404 16:16645161-16645183 TTTTGGATATATACCCAGCATGG + Intergenic
1134769262 16:16792107-16792129 CTTTGGGTATATACCCAGTAGGG - Intergenic
1134992654 16:18713920-18713942 TTTTGGATATATACCCAGCATGG - Intergenic
1137082431 16:36077432-36077454 CTTTGGGTATATACCCAGTAAGG - Intergenic
1138721159 16:59082025-59082047 CTTTGGGTATATACCCAGGAAGG - Intergenic
1138725231 16:59130079-59130101 CTTTGGATATAAACCCAGTAGGG + Intergenic
1138904967 16:61320346-61320368 CTCTGGATTTCTACCCACAAAGG - Intergenic
1139149342 16:64361774-64361796 TTGTGGATGCATACCCAGTAGGG - Intergenic
1141037086 16:80636694-80636716 CTTTGGGTATATACCCAGGATGG - Intronic
1142931339 17:3286415-3286437 CTTTGGGTATATACTCAGTAAGG + Intergenic
1143248725 17:5506412-5506434 TTTTGGGTATATACCCAGCAGGG - Intronic
1143815807 17:9513662-9513684 CTTTGGATAAGTGCCCAGTAGGG - Intronic
1144009381 17:11131835-11131857 TTTTGGATATATATCTAGTAGGG + Intergenic
1144231334 17:13207234-13207256 CTTTGGGTATACACCCAGTAAGG + Intergenic
1144612083 17:16729091-16729113 CTTTGGGTAGATGCCCAGTAGGG + Intronic
1144900651 17:18586291-18586313 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1145131800 17:20359448-20359470 CTTTGGGTAGATACCCAGTAGGG + Intergenic
1146089254 17:29859793-29859815 CTTTGGGTATATATCCAGTAAGG + Intronic
1146423724 17:32715303-32715325 CTTTGGGTATATACCCAGTAAGG - Intronic
1146583860 17:34065020-34065042 CTCTGGATAGATACCCAGTAGGG - Intronic
1149090693 17:52774648-52774670 CTTTGGGTATATACCTAGTAAGG + Intergenic
1149194848 17:54107486-54107508 CTTTGGGTATATACCCAACAAGG - Intergenic
1149220475 17:54411313-54411335 CTTTGGGTATATACCCATAATGG - Intergenic
1149224080 17:54448333-54448355 CTTTGGGTATATACCCATAATGG + Intergenic
1149719969 17:58833730-58833752 TTTTGGGTATATACCCAGTATGG + Intronic
1149884065 17:60323135-60323157 CTTTGGATATATACCTTGCATGG - Intronic
1150021738 17:61622021-61622043 CTATTGATACATACCCAGTTTGG - Intergenic
1150450883 17:65267112-65267134 CTTTGTAGGTATACCCAGTAGGG + Intergenic
1150969140 17:70007289-70007311 CCCTGAATATATACCCTATATGG - Intergenic
1151098135 17:71522773-71522795 TTTTGGATATATACCCAGAATGG - Intergenic
1153404211 18:4717828-4717850 TCTTGGATATATACCCAGCAGGG + Intergenic
1154396148 18:13991221-13991243 ATTTGGATAAATACCCAGTATGG - Intergenic
1155335485 18:24760381-24760403 CTTTGGTTACATACCCAGTAAGG - Intergenic
1155395773 18:25385428-25385450 CTTTGGGTATACGCCCAGTATGG - Intergenic
1156832755 18:41514614-41514636 CTAAGGTCATATACCCAGTAAGG + Intergenic
1156934415 18:42685832-42685854 CTTTAGGTATATACCCAGTAGGG - Intergenic
1157018578 18:43750433-43750455 CTTTGGGTATATACCCAGTAAGG + Intergenic
1157357337 18:46947792-46947814 CTCTGGCTTCATACCCATTATGG + Intronic
1157473268 18:48006033-48006055 ATTTGGATATATACCCAGTAAGG + Intergenic
1157543370 18:48529221-48529243 TTTTGAATATATACCCAGAAGGG - Intergenic
1158793969 18:60818763-60818785 CTTTGGGTATATACCCAGTAAGG + Intergenic
1159296614 18:66498283-66498305 CTATGAATATATACACTGTATGG + Intergenic
1159475777 18:68919271-68919293 CACTGAATATATACTCAGAAGGG + Intronic
1159574755 18:70161999-70162021 TTTTGGGTCTATACCCAGTAAGG - Intronic
1159613360 18:70550801-70550823 CTTTGGGTATATACCCACTAGGG - Intergenic
1159613489 18:70552308-70552330 CTTTGGGTAGATACTCAGTAAGG - Intergenic
1160037211 18:75312657-75312679 CTCTGGAAATTTACCCCTTACGG + Intergenic
1160252471 18:77215188-77215210 CGCCGGATAAATACCAAGTATGG - Intergenic
1160303506 18:77708450-77708472 CTTTGGATCTATACCCAGAGTGG - Intergenic
1163952203 19:20599135-20599157 CTCTGTGTAGATACCCAGTAGGG + Intronic
1164000554 19:21094368-21094390 CTTTGGATATATACTCAATTTGG + Intronic
1164331629 19:24264273-24264295 CTTTGGGTATATATCCAGTAAGG + Intergenic
1164494007 19:28741532-28741554 CTCTGGGCATATACCCAACAAGG - Intergenic
1165373153 19:35422797-35422819 CTTTGGATTTACACCCAGCAGGG + Intergenic
1167848208 19:52181900-52181922 CTTTGGATATATACCATGAAGGG + Intergenic
1168012853 19:53547533-53547555 CTTTGGATATATACCCAGAGTGG + Intronic
1168628703 19:57939696-57939718 CTTTGGATAAATTCCCAGTAGGG - Intergenic
925037392 2:700035-700057 CTTTGGGTATATACTCAGTAAGG + Intergenic
925354208 2:3226140-3226162 CTTTGGATATATACCCAGAATGG + Intronic
925376912 2:3392822-3392844 CTTTGGATACATACCCAGAATGG - Intronic
925550304 2:5066663-5066685 CTCTGGGTATATACCCAGTGAGG - Intergenic
925720778 2:6824547-6824569 CTTTGGGTATATACCCAGTAAGG - Intergenic
926074188 2:9927370-9927392 CTTTGGGTATATACTCAGTAAGG + Intronic
927834735 2:26385437-26385459 CTCTAAATATATTACCAGTATGG + Intronic
928346919 2:30507810-30507832 CTTTGGGTATATATCCAGTAAGG + Intronic
929643026 2:43600658-43600680 CTCTGGGTAGATACCCAGTAGGG - Intergenic
930239185 2:48918260-48918282 CTTTGGGTATATACCCAGTATGG + Intergenic
930710555 2:54547460-54547482 TTTTGGATATATATCCAGAAGGG + Intronic
931307092 2:61040227-61040249 CTTTGGATATATACCCAGTAAGG - Intronic
931420880 2:62126271-62126293 CTTTGGGTATATACCCAGTAAGG + Intronic
931921641 2:67023438-67023460 CTTTGGACATATACCCAATGTGG - Intergenic
932946787 2:76243246-76243268 CTTTGGATAAATACTCAGTATGG + Intergenic
933001919 2:76936079-76936101 CTTTGGGTATATACCCAGTATGG - Intronic
934302293 2:91784473-91784495 CTTTCTGTATATACCCAGTAAGG - Intergenic
934898233 2:98137148-98137170 TTTTGGATATATACTCAGAATGG + Intronic
935439853 2:103079937-103079959 CTTTGGGTAAATTCCCAGTAGGG - Intergenic
935831962 2:107009674-107009696 CTCTGAAAATATACACACTATGG - Intergenic
936717869 2:115210518-115210540 CTTTGGGTGTATACCTAGTAAGG + Intronic
936897838 2:117447889-117447911 CTATGGATGTATACCCAGTAAGG - Intergenic
937424040 2:121782615-121782637 CTCTGGGTAGATACCTAGTAGGG + Intergenic
937731387 2:125234935-125234957 CTCTCGGTATATACCCAGGATGG + Intergenic
938622425 2:133070235-133070257 GTCAGGATAATTACCCAGTAAGG + Intronic
939292001 2:140207809-140207831 CTTTGGGTATATACCCAAAATGG - Intergenic
939370766 2:141297206-141297228 CTTTGGGTATATACCTAGTAAGG + Intronic
939837351 2:147147163-147147185 CTTTGGGTATATACCCAGTAAGG + Intergenic
939975645 2:148714412-148714434 CTTTGGGTATATACCAAGTAAGG + Intronic
940194342 2:151076724-151076746 CTTTGGACATACACCCAGAAGGG - Intergenic
940644690 2:156378444-156378466 TTTTGGATATATACACAGTAAGG + Intergenic
940669170 2:156646563-156646585 CTTTGGGTAAATATCCAGTATGG - Intergenic
941239923 2:163024654-163024676 CTTTGGGTATATACCCAGAATGG - Intergenic
942177613 2:173349552-173349574 GTCTGTTTATATACCCAGTTGGG + Intergenic
942400505 2:175596923-175596945 TTTTGGATATGTACCCAGTAAGG + Intergenic
942529886 2:176898258-176898280 CTTTGGGTAGAAACCCAGTAGGG + Intergenic
942581564 2:177424589-177424611 CTTTGTGTATTTACCCAGTAAGG + Intronic
943138261 2:183943557-183943579 TTTTGAATAAATACCCAGTAGGG - Intergenic
943322595 2:186464104-186464126 CTTTGGGTAGATACCCAATAGGG - Intergenic
943592786 2:189819381-189819403 CTTTGGGTAGATACCCAGTAGGG + Intronic
944359507 2:198836381-198836403 CTTTGGGTATATGCCCAGAAGGG - Intergenic
945131269 2:206575410-206575432 CAGTTGATTTATACCCAGTATGG + Intronic
945227304 2:207545064-207545086 CTTTGGGTATATATCCAGTAAGG + Intronic
945304376 2:208244874-208244896 CACAGGATAAATACCCAGAAGGG + Intronic
945344788 2:208700611-208700633 CTTTGGGTATATACTCAATAAGG + Intronic
945347375 2:208733836-208733858 CTTTGGCTATATACCCATTAAGG + Intronic
945578121 2:211557758-211557780 CTGTGGGTATATACCCAGGAAGG - Intronic
945838615 2:214861740-214861762 CCCTGGGTAGATACCCAGTAGGG + Intergenic
946662077 2:222012174-222012196 CTTTGGATATATATCAAGAAGGG + Intergenic
947071947 2:226298376-226298398 TTTTGAATATATACCCAGAAAGG - Intergenic
947293381 2:228602390-228602412 CTATGGATATATAAACAGTCTGG + Intergenic
947376368 2:229500522-229500544 CTTTGGATATATATCCAGTAGGG - Intronic
947957788 2:234209100-234209122 CTTTGGGTATATACCCAATAAGG + Intergenic
948493328 2:238328086-238328108 TTTTGGATAAATACCCAGAAGGG + Intronic
1169099616 20:2935503-2935525 CTTTAGATATATATCCAATAGGG + Intronic
1169610157 20:7370237-7370259 CTTTGGGTTTATACCCAGTAAGG - Intergenic
1169724627 20:8715576-8715598 TTCTGAATATATTGCCAGTAGGG - Intronic
1170053023 20:12167671-12167693 CCCTGGATATATACCCCCAATGG + Intergenic
1170093551 20:12619703-12619725 CTTTGGGTAAATACCCATTAAGG - Intergenic
1170224801 20:13980626-13980648 CTTTGGATATATACCTAGAGGGG - Intronic
1170923733 20:20703732-20703754 CTCTGGAGTCATACCCAGCAGGG + Intronic
1171051274 20:21861529-21861551 CTCTGGGTAGATCCCCAGTAGGG - Intergenic
1171999480 20:31761755-31761777 TTTTGGATATATACCCAGTAGGG + Intronic
1173707969 20:45127022-45127044 TTTTGGATAAATACCCAGAAGGG + Intergenic
1174653133 20:52146220-52146242 CTTTGGGTATATACCCAGCATGG - Intronic
1176318974 21:5288692-5288714 CTTTGGGCATATACCCAGTAAGG + Intergenic
1176476957 21:7228201-7228223 CTTTGGGCATATACCCAGTAAGG + Intergenic
1177191375 21:17855690-17855712 TCCTGGATATATACCTAGGAGGG + Intergenic
1177348401 21:19901776-19901798 CTTTGGGTATATACCCAGTAAGG + Intergenic
1177722143 21:24920562-24920584 ATTTGGATATATACCCAAAAAGG - Intergenic
1177774818 21:25556446-25556468 CTTTGGGTATATACTCAGAATGG - Intergenic
1178761725 21:35409491-35409513 CTCTGGGTATATACCCAGTATGG + Intronic
1178812834 21:35899136-35899158 CTTTGGGTATATACCCAGTGAGG - Intronic
1179162854 21:38912228-38912250 CTCTGGTTATTTGCCCAGCAAGG + Intergenic
1179326943 21:40356130-40356152 CTTTGGATATATACCCAGAGTGG + Intronic
1179581160 21:42344882-42344904 CTTTGGATAGATACTCAGTGGGG - Intergenic
1180203948 21:46245375-46245397 CTCTGGAGACATGTCCAGTAGGG + Intronic
1180396573 22:12351192-12351214 CTTTGGGCCTATACCCAGTAAGG + Intergenic
949123565 3:417946-417968 CTTTGATTATATATCCAGTATGG - Intergenic
949151478 3:773058-773080 CTTTGGGTATATACCCAGTAAGG + Intergenic
949301128 3:2585330-2585352 CCTTGGGTATATGCCCAGTAAGG - Intronic
949401729 3:3671833-3671855 CTTTGGGTATATACCCAGTAAGG + Intergenic
950848473 3:16038397-16038419 CTTTGGGTATATACTCAGTAAGG + Intergenic
951030183 3:17872843-17872865 CTTTGGGTAGATGCCCAGTAGGG + Intronic
951153915 3:19325825-19325847 CTTTGGGTATGTACTCAGTAAGG - Intronic
951252010 3:20404734-20404756 ATCTGGATATATTCAAAGTATGG - Intergenic
952810074 3:37394217-37394239 CTTTGGGTATATACCCAATAAGG + Intronic
952811098 3:37403763-37403785 TTTTGGGTATATACCCAGCAGGG + Intronic
954339697 3:49943244-49943266 TTTTGGGTATATACCCAGAAGGG + Intronic
954487231 3:50863961-50863983 CTTTGGATATGTACCAAGCAGGG + Intronic
954949272 3:54455094-54455116 CTTTGGATATATACCCAGTAGGG + Intronic
955304046 3:57811587-57811609 TTTTGGCTATATACCCAGAAAGG + Intronic
955595542 3:60586482-60586504 CTCTGGGTTTATATCCAGTAAGG - Intronic
956127519 3:66024925-66024947 CTCTCGATATACAGCCAGAAGGG + Intronic
956357767 3:68412876-68412898 CTTTGGGTATATACCCAGTAAGG + Intronic
957111702 3:75969312-75969334 CTTTGGGTATATACCCAGCAGGG + Intronic
957111714 3:75969416-75969438 CTTTGGGTATGTACCCAGCAGGG + Intronic
957530203 3:81431169-81431191 CTTTGGGTATATACCCAGTAAGG - Intergenic
957642316 3:82871199-82871221 ATCATGATATATAACCAGTAGGG + Intergenic
957693651 3:83604023-83604045 CTTTGGATATATACACAGAAGGG + Intergenic
957931568 3:86885132-86885154 CTCTGGGTAGATACCCAGTAGGG + Intergenic
958079975 3:88735247-88735269 CTCTGGGTAGACACCCAGTAGGG - Intergenic
958132891 3:89452207-89452229 CTTTGGCTATATACCCAGAGTGG + Intronic
958423547 3:93955217-93955239 CTTTGGGTATATACCCAGTAAGG - Intronic
958593049 3:96184652-96184674 TTTTGGATAAATACCCAGAATGG - Intergenic
958775205 3:98474219-98474241 CTCTGGGTGGATACACAGTAGGG + Intergenic
959166048 3:102779728-102779750 CTCTGGAAGAATACCCAGGAAGG + Intergenic
959494363 3:107032188-107032210 CTTTGGGTATATACCCAGTAAGG - Intergenic
959738540 3:109689226-109689248 TTTTGGATATATACCGAGGATGG + Intergenic
960017054 3:112903079-112903101 CTTTGAGTATATACCCAGTAAGG + Intergenic
960251760 3:115463421-115463443 CTTTGGGTATATACCCAGTAAGG - Intergenic
960492107 3:118329851-118329873 CTTTGGATATATACCCAGAATGG - Intergenic
960607482 3:119522048-119522070 CTTTGGATAAATACCTAGTAGGG - Intronic
960772273 3:121207974-121207996 CTTTGGGTATATACCCAGTAAGG - Intronic
960854498 3:122088818-122088840 TTTTGGGTATATACCCAGAAGGG - Intronic
962553567 3:136523068-136523090 CTTTGGATAGATACCCAGTAAGG + Intronic
962707233 3:138056033-138056055 TTTTGGATATATACCCAGAGTGG - Intergenic
962911052 3:139850035-139850057 CTTTGGATATATACCCAGTAAGG + Intergenic
962965089 3:140346001-140346023 CTCTGGATGGAGACCCAGCATGG - Intronic
963695269 3:148559416-148559438 CTTTGGGTATATACCCAGTAAGG + Intergenic
963717358 3:148819146-148819168 CTTTGGGTATATCCCCAGTAAGG + Intronic
964294655 3:155220073-155220095 CTCTGGGTATATACCCATATTGG + Intergenic
964689946 3:159438990-159439012 CTTTGGATATATACCCAGTAAGG + Intronic
964773201 3:160246245-160246267 CTCTGGGTAGATACCCAGTTTGG - Intronic
965241639 3:166207821-166207843 CTTTGGATATATACCCAGTTAGG + Intergenic
965378214 3:167953780-167953802 CTCTGGCTAGATACCCATTACGG + Intergenic
965383323 3:168016533-168016555 CTTTGGGTATATACCCAGTAAGG - Intronic
965477642 3:169177107-169177129 CTTTGGGTATATACCCAGTAAGG - Intronic
965617117 3:170605581-170605603 CTGTGGATCTATATCCAGGAAGG + Intronic
965714998 3:171593672-171593694 CTTTGGATATATACCCAGAGTGG + Intergenic
965891153 3:173515005-173515027 TTTTGGATAAATACCCAGAATGG + Intronic
966010356 3:175067730-175067752 TTTTGGATATATACCTAGTAGGG - Intronic
966339710 3:178912160-178912182 CTTTGGGTATATACCTAGTAAGG - Intergenic
966486166 3:180472943-180472965 CTTTGGATATATAACCAGTGTGG - Intergenic
966654998 3:182346257-182346279 CTTTGGGTATATACCCAGTATGG - Intergenic
967398680 3:189035911-189035933 CTCTGGGTATAGACCCAGTAAGG - Intronic
967479383 3:189956528-189956550 CTCTGGATCAATGCCCAGTTTGG + Intergenic
967589123 3:191251775-191251797 ATCTAGAGATATACCAAGTATGG + Intronic
968705896 4:2077364-2077386 CTGTGGATGTACACCCAGGAGGG - Intronic
969165205 4:5303181-5303203 CTCAGGGTAGATACCCAGGAGGG + Intronic
969883803 4:10197486-10197508 CTTTGGGTATATACCCAGTTAGG + Intergenic
971656420 4:29351871-29351893 CTTTGGGTATATAGCCAGTAGGG + Intergenic
972222381 4:36970573-36970595 TTTTGGATATATACCCAGGATGG - Intergenic
972963044 4:44476872-44476894 CTCTGGGTATATGCCCAGTAAGG - Intergenic
973666916 4:53169549-53169571 CTTTGGATATATACCCAAAGTGG + Intronic
973922264 4:55700002-55700024 CTTTGGGTATATACCCAGTAAGG - Intergenic
974458152 4:62155173-62155195 CTCTGGGTAGATACCCAGTAGGG - Intergenic
974916933 4:68189347-68189369 ATCTGGAGATATTCCCAGGAAGG + Intergenic
975163357 4:71148891-71148913 CTCTGCATATATACCTAGTAAGG + Intergenic
975304566 4:72834649-72834671 CTCTGGGTATATACCCACTGAGG - Intergenic
975374364 4:73626413-73626435 ATTTGGTTATATACCCAGAAGGG + Intergenic
975896618 4:79100163-79100185 CTTTGGATACATACCCAACATGG + Intergenic
976105240 4:81610244-81610266 CTTTGGATATAGACTCAGTAAGG - Intronic
976328907 4:83805164-83805186 CTGTGGATATATACCCAGAATGG - Intergenic
976572482 4:86629002-86629024 CTTTGGGTATATACCCAGTCAGG + Intronic
976680894 4:87754595-87754617 CTTTGGGTATATACCCAGTATGG + Intergenic
976821154 4:89208608-89208630 TTTTGGATATGTACCCAGAAGGG + Intergenic
977063589 4:92286490-92286512 CTTTGGATATATACCCAGTAGGG + Intergenic
977547416 4:98400204-98400226 CTTTTGATAAATACCCAGTAAGG - Intronic
977771220 4:100863287-100863309 CTTTGGGTATATGCCCAGTCAGG + Intronic
977777663 4:100940128-100940150 CTCTGGATAGATACCTAGTGTGG - Intergenic
978052305 4:104216667-104216689 CTTTGGGTATATTCCCAGTATGG - Intergenic
978176401 4:105737091-105737113 TTTTGGATATATATCCAGCAAGG + Intronic
978252107 4:106643582-106643604 CTTTGGATAAATACCCAGTATGG + Intergenic
978315887 4:107436799-107436821 CTTTAAGTATATACCCAGTAAGG - Intergenic
980065608 4:128185177-128185199 TTTTGGATATATATCCAGCAGGG + Intronic
980514526 4:133837675-133837697 CTTTGGGTATATACCCAGAAGGG + Intergenic
980524857 4:133976460-133976482 CTTTCGGTTTATACCCAGTAAGG + Intergenic
981397069 4:144264200-144264222 CTTTGGATATATAACCAGCAGGG - Intergenic
981699466 4:147593217-147593239 CTCTGGGCAGATACCCAATAGGG - Intergenic
981738517 4:147978174-147978196 TTTTGGATATATACCCAGTAAGG + Intronic
981838968 4:149089093-149089115 CTTTGGGTATATACCCAGTAAGG + Intergenic
982079252 4:151771561-151771583 CTCTGGATATTAACCCAGCCAGG - Intergenic
982507186 4:156234115-156234137 CTTTGGGTATATACCCAGTAAGG - Intergenic
984010185 4:174361275-174361297 TTTTGGATATATATCCAGTAAGG - Intergenic
984143987 4:176038759-176038781 TTTTGGGTATATTCCCAGTAAGG + Intergenic
984338963 4:178429328-178429350 TTTTGGATATATACACAGCAGGG - Intergenic
984481354 4:180306985-180307007 CTTTGGGTATATACTCAGTATGG + Intergenic
984592054 4:181627836-181627858 CTTTGGGTATATGCCCAGTAAGG + Intergenic
984625615 4:182004574-182004596 CTTTGGGTATATACCCAGTAAGG + Intergenic
985091744 4:186370197-186370219 CTTTGGGTATATACCCAGTAAGG - Intergenic
985109287 4:186532721-186532743 CTTTGGGTATATACCCAGTAAGG + Intronic
985249431 4:188008542-188008564 CTTTGGCTATATGCCCAGAAAGG + Intergenic
985436263 4:189932066-189932088 CTTTGAATATACACCCAGTAGGG - Intergenic
985793132 5:1942529-1942551 TTTTGGATATATACCCAGGAGGG + Intergenic
986359045 5:6957758-6957780 CTTTGGGTATATACCCAGTAAGG - Intergenic
986373535 5:7106369-7106391 CTTTGAGTATATACCCAGTAAGG + Intergenic
986482969 5:8207406-8207428 CTTTGAATATACACCCAGCATGG + Intergenic
987199515 5:15561563-15561585 CTTTGGATATATACCCAGCAGGG + Intronic
987520775 5:18980546-18980568 CTTTGGATATATAGCCAGAATGG + Intergenic
987565325 5:19576728-19576750 CTTTGGCTATATACCCAGTCAGG - Intronic
987669313 5:20986678-20986700 CTTTGGGTATATACCCAGTAAGG + Intergenic
988084456 5:26457452-26457474 CTTTGGTTATATACTCAGTGAGG + Intergenic
988316648 5:29639667-29639689 CTTTGGATGTATACCCTGTAGGG - Intergenic
988324416 5:29743425-29743447 CTTTGGGTATATGCCCAGTATGG - Intergenic
988394887 5:30684163-30684185 CTTTGGATATATATCTAGAAAGG - Intergenic
988412871 5:30909721-30909743 CTTTGGGTATATACCCAGTAAGG - Intergenic
988637372 5:32999595-32999617 CTCTGGGTAGATACCTAGCAGGG + Intergenic
988848464 5:35154630-35154652 CTTTGGGTATATACTCGGTAAGG - Intronic
989304736 5:39940337-39940359 CTCTGGGTTGATACCCAGTATGG + Intergenic
989392628 5:40917627-40917649 CTTTGGCTATATACCCTGTAGGG + Intronic
989607575 5:43259254-43259276 CTTTGGGGAGATACCCAGTAGGG + Intronic
990090157 5:52035080-52035102 CTCTGGATATGTACTCAGGAAGG - Intronic
990770001 5:59232660-59232682 CTTTAGATAAACACCCAGTAGGG - Intronic
990859871 5:60314986-60315008 CTTTGGGTATATACCCAGTAAGG + Intronic
990898513 5:60725621-60725643 TTTTGGATATATACCCAGAGTGG + Intergenic
991147870 5:63328289-63328311 TTTTGGATATATATCCACTAAGG + Intergenic
991172220 5:63641739-63641761 CTTTGGGTAGATACCCAGTAGGG + Intergenic
991239359 5:64439867-64439889 CTTTGGATATATTCCCAGAAAGG - Intergenic
991484987 5:67125752-67125774 CTTTGAGTATATACCCAGTAAGG + Intronic
992183361 5:74220085-74220107 CTTTTGGTATATACCCAGTATGG - Intergenic
992845646 5:80744057-80744079 CTCTAGGTATTTACCCAGGAAGG - Intronic
992899122 5:81275714-81275736 CTCTGGGTAGATGCCCAATAGGG - Intergenic
993212658 5:84974259-84974281 CTTTGGCTAGATACCCAGGAGGG + Intergenic
993683105 5:90904262-90904284 TTTTGGGTATATACCCAGCAGGG + Intronic
994263544 5:97687672-97687694 CTCTGGGTATATACCAATAATGG - Intergenic
994357356 5:98808825-98808847 CTCTGGATAAATGCCCATAATGG - Intergenic
994438548 5:99770035-99770057 TTTTGGGTATATACCCAATAAGG - Intergenic
994777708 5:104055868-104055890 CTCTGGGTCAATACCTAGTAGGG + Intergenic
995174677 5:109161740-109161762 CTTTGGGTATATGCCCATTATGG + Intronic
995535667 5:113133626-113133648 TTTTGGATATATACCCAGTAAGG + Intronic
995816232 5:116171469-116171491 ATCTGGGTATATACCCAGTAAGG - Intronic
995974944 5:118023070-118023092 CTTTGGGTATATACCCAGAAGGG - Intergenic
996005364 5:118414599-118414621 CTTTGGATATATACCCTGCAAGG - Intergenic
996429378 5:123355285-123355307 CTTTGGGTATATACCCAGTAAGG + Intronic
996928596 5:128858958-128858980 ATTTGGGTATATACCCAGTATGG + Intronic
997140675 5:131376991-131377013 CTTTGGGTATATACTCAGTAAGG + Intronic
997186540 5:131887340-131887362 CTTTGGGTATATACCCAGTAAGG + Intronic
997887601 5:137644520-137644542 CTTTGGATGCATACCCAGTATGG + Intronic
999022309 5:148180746-148180768 CTTTGGGTATATACCCAGAGTGG + Intergenic
999346292 5:150822770-150822792 CTTTGGGTATATACCCAATAAGG - Intergenic
999546031 5:152629586-152629608 TTTTGGGTATATACCCAGCAGGG + Intergenic
1000215154 5:159148112-159148134 CTTTGGATATATACCCAGATAGG - Intergenic
1000224263 5:159244092-159244114 CTCTTGATATATTCCCAGGTGGG + Intergenic
1000377618 5:160598029-160598051 TTTTGGGTATATACCCAGGATGG - Intronic
1000384669 5:160663280-160663302 CTTTGGGTATATTTCCAGTAAGG - Intronic
1000668137 5:164024527-164024549 CTTTGGGCATATATCCAGTAAGG + Intergenic
1002379549 5:178816661-178816683 CTATGGAGGTCTACCCAGTAGGG - Intergenic
1002651524 5:180699810-180699832 TTCTGGGTATATGCCCAGCAAGG - Intergenic
1002681142 5:180965881-180965903 CTTTTGATATTTACCCAGTAGGG - Intergenic
1002867461 6:1134732-1134754 TACTGGGTATATGCCCAGTATGG - Intergenic
1003621657 6:7706064-7706086 CTGAGGAAAAATACCCAGTACGG - Intergenic
1004095979 6:12554824-12554846 CTTTGGGTATATACCCAGTAAGG - Intergenic
1005770879 6:29069804-29069826 CTCTGAGTAGATACCCAGTAAGG - Intronic
1006916661 6:37599041-37599063 CTTTGGGTATATACCTAGTAAGG + Intergenic
1007343226 6:41207111-41207133 CTCTGTATATGTACCCGGGAAGG + Intergenic
1008171781 6:48216664-48216686 CTCTGGGTTGATATCCAGTAGGG + Intergenic
1008293569 6:49749906-49749928 CTTTGGATATAGATCCAATAGGG + Intergenic
1008463609 6:51805020-51805042 CTTTGGATATATACCCAGTAAGG - Intronic
1010079369 6:71841107-71841129 ATCTGGATAAATACCAAGCAAGG + Intergenic
1010195169 6:73232290-73232312 TTCTGGGTATATACCCAGTAAGG - Intronic
1011229654 6:85146102-85146124 CTTTGGATATATACCCAGTATGG + Intergenic
1011571461 6:88741087-88741109 CTTTAGATATATACCCAGTAAGG - Intronic
1011994266 6:93565600-93565622 CTTGGGGTATATACCCAGTATGG + Intergenic
1012688835 6:102288126-102288148 CTTTTGATAAATACCCAGTAGGG - Intergenic
1012706969 6:102543879-102543901 TTTTGGGTATATACCCAGGAGGG - Intergenic
1014294151 6:119597763-119597785 TTTTGGGTATATACTCAGTAGGG + Intergenic
1014348689 6:120310583-120310605 CTTTAGATAGATACCCAGTAGGG + Intergenic
1014355393 6:120402547-120402569 TTTTGGATATATACCCAGCAGGG + Intergenic
1014423456 6:121272750-121272772 CTTTGGGTATATACCCAGTAAGG - Intronic
1014511781 6:122331434-122331456 CTTTGGGTATATACCCAGTATGG - Intergenic
1014581813 6:123147148-123147170 TTCTGGGTAGATACCCAGTAGGG - Intergenic
1014636312 6:123851195-123851217 CTTTGGATATATACTCAGTAGGG + Intronic
1015043836 6:128755461-128755483 CTTTGGGTATATACCCAGGTGGG + Intergenic
1015153706 6:130066426-130066448 CTCTGGATATCCACCCAGTTGGG + Exonic
1015281473 6:131439446-131439468 CTTTGGATATACACCCAGTAAGG - Intergenic
1015491558 6:133832496-133832518 CTTTGTGTATATATCCAGTAAGG - Intergenic
1015563221 6:134538662-134538684 CTTTGGGTATATATCCAGAATGG - Intergenic
1016542878 6:145185980-145186002 TTTTGGGTATATGCCCAGTAAGG - Intergenic
1018271976 6:162089528-162089550 TTTTGGATATATACCTAGAAGGG - Intronic
1019035756 6:169057230-169057252 CTTTGGGTATATGCCCATTATGG - Intergenic
1019972778 7:4554955-4554977 CTTTGGGTATATACTTAGTAAGG + Intergenic
1020771242 7:12398050-12398072 CCCTGGGTATATACCCATAATGG - Intronic
1021057839 7:16072656-16072678 CTTTGGATATATACCCAGAGTGG - Intergenic
1021351288 7:19596980-19597002 CTTTGTATATATACCCAGTAAGG + Intergenic
1021367412 7:19796906-19796928 CTTTGGATAAATATACAGTATGG + Intergenic
1021535548 7:21700600-21700622 CTTTGGGTATATACCTAGAAAGG - Intronic
1023218375 7:37890948-37890970 CTTTGGATATATACCCATAGTGG + Intronic
1023236438 7:38095166-38095188 CTTTGGGTATATACCCAGAAAGG - Intergenic
1023238814 7:38120092-38120114 CCTTGGGTATATACCCAGAATGG - Intergenic
1023631543 7:42169601-42169623 CTTTGGGTATGTACCCAGCAAGG - Intronic
1024171592 7:46793234-46793256 CTTTGGATATATACCCAGAAGGG + Intergenic
1024742337 7:52367919-52367941 CTTTGGGTGTATACCCAGTAAGG + Intergenic
1024929120 7:54651342-54651364 CTCAGGATATAAACCAAGTAGGG + Intergenic
1024949951 7:54850197-54850219 CTTTGGGTATATACCCAGTATGG + Intergenic
1025966674 7:66279430-66279452 CTGTGGGTATATATCCAGTAAGG + Intronic
1026133528 7:67639941-67639963 CTTTGAATATATACCTGGTAAGG + Intergenic
1026883385 7:73921372-73921394 CCCTGGATATATATACAGTTGGG + Intergenic
1026974951 7:74491828-74491850 CTTTGGGTATATACCCAGTAAGG + Intronic
1027110236 7:75432344-75432366 CTGTGGTTATATTCCCAGTGCGG + Intronic
1027349485 7:77296098-77296120 CTCTGGATAAATTTCCAGTAGGG + Intronic
1027641226 7:80735826-80735848 CCTTGGGTATATAACCAGTAAGG - Intergenic
1028045496 7:86112434-86112456 CTTTGGATATATAACCAGTAGGG + Intergenic
1028064800 7:86370111-86370133 CTTTGGATAAATATTCAGTAGGG + Intergenic
1028105634 7:86874862-86874884 CTTTGGGCATATACCCAGTGTGG - Intergenic
1028208654 7:88046066-88046088 CTTTGGATGCATACCCAGAAGGG + Intronic
1028348275 7:89811220-89811242 CTCTGGGTAGATACCCAGTAGGG - Intergenic
1028402401 7:90438299-90438321 CTCTGGGTAGATACCCAGCAGGG - Intronic
1028681677 7:93541945-93541967 TTTTGGATATAAACACAGTATGG + Intronic
1028692960 7:93674660-93674682 CCTTGGGTATATACCCAGCAAGG - Intronic
1028969572 7:96842726-96842748 CTTTGGATATATACCCAGTAAGG + Intergenic
1029863628 7:103602322-103602344 CTTTGGGTATATACCCATAATGG - Intronic
1030471648 7:109971358-109971380 CTTTGAATATATACCTAATATGG - Intergenic
1030522457 7:110615076-110615098 CTTTGGATATAAACCTAGTAGGG + Intergenic
1030559277 7:111064631-111064653 CTCTGGATTTAAGACCAGTAGGG - Intronic
1030813480 7:114005270-114005292 CCCTGGGTATATACTCAGTAAGG - Intronic
1031325474 7:120391416-120391438 TTCTGGGTATATACCCAGTAAGG + Intronic
1033626641 7:143116933-143116955 CTTTGGGTATATACCCAGTAAGG - Intergenic
1034486398 7:151366823-151366845 CTTTGAATATATACCAAGAACGG + Intronic
1035069395 7:156130540-156130562 CTTTGGGTATATACCCAGGTGGG - Intergenic
1037159084 8:15745309-15745331 CTTTGGGTGTATACCCAGTAAGG + Intronic
1037257765 8:16974351-16974373 CTTTGGGTATATACCCAGTATGG + Intergenic
1038892407 8:31740859-31740881 TTTTGAATATATACCCATTATGG - Intronic
1039173603 8:34778926-34778948 CTTTGGATATATACCCAGTATGG - Intergenic
1039400387 8:37264093-37264115 TTTTGGATAAATACCCAGTAGGG - Intergenic
1039807990 8:41018798-41018820 CTTTGGGTATATACCCAGTGAGG + Intergenic
1039809528 8:41033989-41034011 CTTTGGGTATATACCCAGTGAGG - Intergenic
1040357059 8:46628877-46628899 CTTTGGGTATATACCCAATAAGG - Intergenic
1040809842 8:51439881-51439903 CTCTGGGTAAATATCCAGTAGGG - Intronic
1041817141 8:61986719-61986741 CTCAGGATATATAGCTAGTCTGG + Intergenic
1041900126 8:62973171-62973193 CTTTGGGTATACACCCAGTAGGG + Intronic
1042000466 8:64118025-64118047 CTTTAGATGAATACCCAGTAGGG - Intergenic
1042799180 8:72699835-72699857 CTTTGGGTATATACCCATAATGG - Intronic
1043252003 8:78086712-78086734 CTTTGGGTAGATACCCAGTAGGG + Intergenic
1043629793 8:82315521-82315543 TTTTGGGTATATACCCAGTAAGG + Intergenic
1043788414 8:84431890-84431912 CTTTGGTTATATACCCAGTGGGG + Intronic
1043840764 8:85101054-85101076 CTATAGATAATTACCCAGTAGGG + Intergenic
1044126276 8:88461499-88461521 CTTTGGGTATATACCCAAAATGG + Intergenic
1044163404 8:88949088-88949110 CTCTGTATATATACTCAGATAGG - Intergenic
1044221732 8:89677754-89677776 CTTTGGGTGTATACCCAGTAAGG - Intergenic
1044366132 8:91348020-91348042 CTCGGGAGGTATACCCAGGAGGG + Intronic
1044384623 8:91572895-91572917 CTTTGGGTATACACCTAGTAAGG - Intergenic
1044440230 8:92215409-92215431 CTTTGGGTATATCCCCAGTAAGG + Intergenic
1046151066 8:110226760-110226782 CTTTGGATATATACCTAGAAAGG + Intergenic
1046188116 8:110749417-110749439 CTTTGGACATATACCCAGAAGGG - Intergenic
1046266796 8:111841051-111841073 ATTTGAATATATACCCAGTAGGG - Intergenic
1047297608 8:123585120-123585142 CTCTTGCTGTATACCCACTATGG + Intergenic
1047383733 8:124388905-124388927 CTTTGGGTAGATACCCAGTAGGG + Intergenic
1048435878 8:134417064-134417086 CTTTGGGTATATACCCAGTATGG - Intergenic
1049077823 8:140414010-140414032 CTTTGGGTATATACCCAGTAAGG + Intronic
1050368509 9:4896578-4896600 CTTTGGGTATATACCCAGTAAGG + Intergenic
1050761642 9:9079498-9079520 CTTTGGATAGATTCTCAGTAGGG + Intronic
1051567653 9:18518649-18518671 CTTTGGTTAGATACCCAGTGTGG + Intronic
1052114611 9:24635113-24635135 CTTTAGGTATATACCCAGAATGG + Intergenic
1052694901 9:31865241-31865263 CTTTGGGTATATACCCAGTATGG + Intergenic
1052696308 9:31883661-31883683 CTTTGGGTATATATCCAGTATGG + Intergenic
1053625446 9:39866303-39866325 CTTTGGATATATACCTAGATGGG + Intergenic
1053879416 9:42576920-42576942 CTTTGGATATATACCCAGATGGG - Intergenic
1053893242 9:42717439-42717461 CTTTGGATATATACCTAGATGGG + Intergenic
1054218442 9:62384398-62384420 CTTTGGATATATACCTAGATGGG - Intergenic
1054232274 9:62524777-62524799 CTTTGGATATATACCCAGATGGG + Intergenic
1054995939 9:71389472-71389494 CTCTGGGTAGATACCCAGGAGGG - Intronic
1055153686 9:73035281-73035303 TTCTGGAAATATATCCAGAATGG + Intronic
1055162435 9:73146509-73146531 ATATGGATATATACCCATCAGGG - Intergenic
1055182639 9:73407069-73407091 TTCTGGGTATATACCTATTATGG + Intergenic
1055283627 9:74703785-74703807 CTCTGGGTAGATACCTAATAGGG + Intergenic
1055585471 9:77754798-77754820 CTATGGAGATATAACCAGTATGG + Intronic
1055903009 9:81262703-81262725 CTTTGGCTATATACCCAGTATGG - Intergenic
1056040020 9:82655638-82655660 TTTTGGATATGTATCCAGTAGGG + Intergenic
1056994010 9:91438009-91438031 CTTTGGGTATATGCCCAGAAAGG + Intergenic
1057238672 9:93389200-93389222 CTTAGGATAAATACCCAGAAAGG + Intergenic
1057752113 9:97801595-97801617 CTCTCAATACATTCCCAGTATGG + Intergenic
1058307955 9:103466252-103466274 CTCTGGGTAGATACCCAGTAGGG + Intergenic
1058578972 9:106434488-106434510 CTTTGGGTATATACCCAGAGGGG + Intergenic
1058783302 9:108361407-108361429 GTTTGGGTATACACCCAGTAAGG - Intergenic
1059236724 9:112766954-112766976 ATATGGATATATACCTAGAAGGG + Intronic
1060708860 9:125835839-125835861 TTTTGGATATATGCCCAGCAGGG - Intronic
1061298938 9:129693697-129693719 CTCTGGACATATTTCCAATAGGG - Intronic
1203412390 Un_KI270579v1:30882-30904 CTTTGGGCATATACCCAGTAAGG + Intergenic
1185686393 X:1932358-1932380 CTTTGGATAAATTCCCAGCAGGG + Intergenic
1186135018 X:6510400-6510422 CTTTGGGTATATACCCAGCAAGG - Intergenic
1186737066 X:12476946-12476968 CTTTGGGTATATACCCAGGCTGG - Intronic
1186920901 X:14279122-14279144 CTTTGGATGAATACCCAATAGGG - Intergenic
1186941556 X:14513906-14513928 CTCTGGGTAGATGCCCAGTAAGG - Intergenic
1188194921 X:27221813-27221835 CTTTGAGTATATACCCAGTAAGG + Intergenic
1188813907 X:34687440-34687462 TTTGGGGTATATACCCAGTAGGG + Intergenic
1188863275 X:35284429-35284451 CTTTGGATATATGCCCAGGAAGG - Intergenic
1188929770 X:36093258-36093280 TTTTGGCTATATACCCAGCAAGG + Intronic
1189017960 X:37303714-37303736 CTCTGGGTATATAACCAGTATGG + Intergenic
1189573631 X:42326357-42326379 CTCTGGGTATATGCCCAGTAAGG - Intergenic
1189627201 X:42911523-42911545 TTTAGGATATATACCCAGCAGGG - Intergenic
1189660781 X:43295987-43296009 CTTTGGGTATATACCCAGAATGG - Intergenic
1190462692 X:50694208-50694230 TTCTGAATATGTACCCAGCAGGG + Intronic
1190500291 X:51069235-51069257 CTTTGGCTATATATCCAGAAGGG - Intergenic
1190505602 X:51123049-51123071 CTTTGGATATATATCCAGAAGGG + Intergenic
1190587352 X:51959865-51959887 CTTTGGGTATATACCCAGTAAGG + Intergenic
1190591609 X:52008238-52008260 CTTTGGGTATATACCCAGTAAGG + Intergenic
1191058425 X:56268304-56268326 CTTTGGATATATACCCAGAAGGG + Intronic
1191072254 X:56412856-56412878 CTTTGGGTATATATCCAGTAAGG + Intergenic
1191205780 X:57832917-57832939 CTTTGGGTATATACCCAGTAAGG - Intergenic
1191597469 X:62961260-62961282 CTTTGAGTATATACCCAGTAAGG + Intergenic
1191789469 X:64953809-64953831 CTTTGGGTATATACCCAGTAAGG - Intronic
1192015903 X:67330599-67330621 CTTTGGGTACATACCCAGTAGGG - Intergenic
1192075266 X:67988648-67988670 CTTTGGATAGATATCCAGTGGGG - Intergenic
1192749347 X:73972277-73972299 CTTTGGATATGTACCCAAAAGGG + Intergenic
1192935319 X:75852577-75852599 CTTTGAGTATATACCCACTAAGG + Intergenic
1192944027 X:75945372-75945394 CTTTGGGTATATACCCATAATGG + Intergenic
1192967103 X:76189649-76189671 CTTTGTATATATACTCAGAAAGG + Intergenic
1192987339 X:76414453-76414475 CTGTGGGTAGATACCTAGTAGGG - Intergenic
1192992611 X:76476857-76476879 CTTTGGGTATATACCCATAATGG - Intergenic
1193299170 X:79868469-79868491 CTCTTGATAGATAACCAGTGTGG - Intergenic
1193335846 X:80287838-80287860 ATTTGAATATATACCCAGGAAGG - Intergenic
1193446521 X:81611578-81611600 CTCTGGATAGATACCCAGAGTGG + Intergenic
1194096450 X:89645425-89645447 TTTTGGATATATACCCAGTAAGG - Intergenic
1194207954 X:91034283-91034305 CTTTGAGTATATATCCAGTAAGG + Intergenic
1194264146 X:91734532-91734554 CTCTGGGTAGATACCCAGTAGGG + Intergenic
1194588795 X:95771217-95771239 CTTTGGATATATACCCAGTAAGG - Intergenic
1194990062 X:100537626-100537648 CTTTGGGTATATACCCAGTAAGG + Intergenic
1195223680 X:102770437-102770459 CTTTGGATATATACTCAGAAGGG + Intergenic
1195501530 X:105606542-105606564 CTTTGGATATATATCCTGTAGGG - Intronic
1196531370 X:116790838-116790860 CTTTGGGTATATACCCAGTAAGG - Intergenic
1196646308 X:118120964-118120986 CTTTGAATATATACCCAGAGAGG - Intergenic
1196913939 X:120512739-120512761 CTCTGAAAATATCCCCAGTGGGG + Intergenic
1197102944 X:122678148-122678170 CTCTGGGTAGATACCTGGTAGGG - Intergenic
1197274285 X:124460219-124460241 CTTTGAGTATATACCCAGTAAGG - Intronic
1197615831 X:128690554-128690576 CTTTGGGTATATACCCAATAAGG + Intergenic
1197958153 X:131975165-131975187 CTCTGGGTAGATACCCAGTATGG + Intergenic
1198222458 X:134615076-134615098 CTTTGGGTATATATCCAGAAGGG + Intronic
1198585100 X:138111672-138111694 CTTTGTATAAATACTCAGTAGGG - Intergenic
1198672683 X:139098362-139098384 CCTTGGGTATATACCCAGTAGGG - Intronic
1199090191 X:143682121-143682143 ATCTGGGTATATAACCAGTAAGG + Intergenic
1199193625 X:145001589-145001611 CCTTGGGTATATACCCAATAAGG + Intergenic
1199253243 X:145689112-145689134 CCCTGGGTATATAACCAATAAGG + Intergenic
1199490477 X:148393438-148393460 CTTTGGATAGGTACCTAGTAGGG - Intergenic
1199588841 X:149446638-149446660 CTGTGGCTATATACCCAGTAAGG + Intergenic
1200449462 Y:3306807-3306829 TTTTGGATATATACCCAGTAAGG - Intergenic
1200717258 Y:6562251-6562273 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1201192257 Y:11454978-11455000 TTTTGGATATATATCCAGTAAGG + Intergenic
1201244439 Y:11989113-11989135 CTTTGGGTATATACCCAGTAAGG + Intergenic
1201364643 Y:13190172-13190194 CTTTTGGTATATACCCAGTAAGG + Intergenic
1201535356 Y:15041947-15041969 CTTGGGGTATATACCCAGTAAGG + Intergenic
1201535925 Y:15048209-15048231 CTTTGGCTATATACCCAGTAAGG + Intergenic
1202351792 Y:24000595-24000617 CTTTGGTTATATGCGCAGTAAGG - Intergenic
1202518987 Y:25669524-25669546 CTTTGGTTATATGCGCAGTAAGG + Intergenic