ID: 1115691301

View in Genome Browser
Species Human (GRCh38)
Location 14:35846744-35846766
Sequence GTAAGTTTACCTGGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115691301_1115691307 7 Left 1115691301 14:35846744-35846766 CCAGTTTCCCCAGGTAAACTTAC 0: 1
1: 0
2: 2
3: 7
4: 122
Right 1115691307 14:35846774-35846796 CCATTGTGATAAATATTTTGAGG 0: 1
1: 0
2: 0
3: 29
4: 373
1115691301_1115691308 13 Left 1115691301 14:35846744-35846766 CCAGTTTCCCCAGGTAAACTTAC 0: 1
1: 0
2: 2
3: 7
4: 122
Right 1115691308 14:35846780-35846802 TGATAAATATTTTGAGGAGAAGG 0: 1
1: 0
2: 4
3: 64
4: 750

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115691301 Original CRISPR GTAAGTTTACCTGGGGAAAC TGG (reversed) Intronic
901117926 1:6863712-6863734 GTAATGTTAGCAGGGGAAACAGG - Intronic
901189193 1:7395294-7395316 GTAAGTTTTGCTGGGAAAACTGG - Intronic
902471406 1:16649295-16649317 GTTAGCTTGCCTGGGGAAAGGGG - Intergenic
902487404 1:16758150-16758172 GTTAGCTTGCCTGGGGAAAGGGG + Intronic
903226995 1:21899499-21899521 GTCAGGTTACCCGTGGAAACTGG + Intronic
905155186 1:35972036-35972058 GTTACTTTACCTGGGGAAGGTGG + Exonic
909147416 1:71954063-71954085 GTAAAATTAGCTGGGGAAATAGG + Intronic
911391893 1:97255750-97255772 GTAATCTAACCAGGGGAAACTGG + Intronic
911568479 1:99493486-99493508 ATAATTTTCACTGGGGAAACAGG - Intergenic
913597417 1:120392308-120392330 GTGAGGTTACCTGTGTAAACTGG - Intergenic
914089913 1:144487006-144487028 GTGAGGTTACCTGTGTAAACTGG + Intergenic
914308697 1:146447210-146447232 GTGAGGTTACCTGTGTAAACTGG - Intergenic
914512607 1:148347119-148347141 GTGAGGTTACCTGTGTAAACTGG + Intergenic
914593412 1:149125921-149125943 GTGAGGTTACCTGTGTAAACTGG + Intergenic
914861490 1:151389929-151389951 GTAGGCTTTCCTGGGGAAAGGGG - Intergenic
916514243 1:165500249-165500271 ATAAGTTAACCTGGGGAGGCTGG - Intergenic
917034391 1:170731164-170731186 GTAAATTTCCCTAGGAAAACTGG + Intronic
918939755 1:190977423-190977445 GTCAGTTTCCCTGGAGAAAAAGG - Intergenic
1063351206 10:5357082-5357104 TCTAGTTTCCCTGGGGAAACAGG - Intergenic
1064073780 10:12252398-12252420 GCACATTTTCCTGGGGAAACTGG + Intergenic
1064390093 10:14934680-14934702 GTAAGTCTGCCTGGAGGAACAGG - Intronic
1068548538 10:58380239-58380261 TTAAATTTACCTGGGAAAGCAGG - Intergenic
1071687829 10:87779996-87780018 GTAGGTTTTCCTGTGGACACAGG - Intronic
1076832159 10:133001124-133001146 CTAAGTTTATCTGGGGGAAGTGG - Intergenic
1078820917 11:14881023-14881045 GTAATTTAACCTGGTGAAATAGG + Intronic
1079380162 11:19931254-19931276 GGATGTTTTCCTGGGGAGACTGG - Intronic
1085658098 11:78335465-78335487 GTAAGTGTTGCTGGGAAAACTGG - Intronic
1086966189 11:93031039-93031061 GTACGTTAACTTGGGGAAACGGG - Intergenic
1093137755 12:15472540-15472562 GTGAGTTTGCCAGGGGAATCTGG - Intronic
1095433788 12:42165288-42165310 GTCAGTATACCAGGAGAAACAGG + Intronic
1099905644 12:88766383-88766405 GTAAGCTTACCTGAAGAAGCTGG - Intergenic
1103280945 12:119757484-119757506 GAAATTTTACCTGGAGACACAGG - Exonic
1107125879 13:36846184-36846206 GTAAGATTACCAGAGGAAGCCGG + Exonic
1111322916 13:86653273-86653295 GTAATTTTCCCTGAGGAATCTGG - Intergenic
1111698545 13:91657322-91657344 GTCAGTGTATCTTGGGAAACTGG + Intronic
1115691301 14:35846744-35846766 GTAAGTTTACCTGGGGAAACTGG - Intronic
1116537278 14:46048389-46048411 GGAACTTTGCCTGGGGACACAGG - Intergenic
1119069696 14:71570124-71570146 GTTGGTTTACCTGGGGAAACTGG - Intronic
1119143986 14:72293897-72293919 GTAAACTTACTTGTGGAAACGGG + Intronic
1125395644 15:39244561-39244583 GTGAGTTCACCTGTTGAAACAGG - Intergenic
1132197115 15:99923735-99923757 TTAAGATGACCTGGGGTAACTGG - Intergenic
1132335668 15:101046821-101046843 GTGGGTTTACCTGGGGTTACAGG + Intronic
1139461421 16:67125690-67125712 GTAAAAATACCTGGGGAAAAGGG - Intronic
1142794292 17:2295512-2295534 GTTAATTTAGTTGGGGAAACTGG - Intronic
1155410672 18:25541379-25541401 GTAGGTTTACCAGGTGAAATGGG + Intergenic
1157086759 18:44588339-44588361 CTATGTATACCTGGGGAAAGGGG + Intergenic
1157585640 18:48799481-48799503 GTATTTTTATCTGGGGACACTGG + Intronic
1158272342 18:55730060-55730082 GTTACTTTTCCTGGGGAGACAGG - Intergenic
1158296914 18:56008418-56008440 GTAAGTTTAGCTAGGAGAACTGG + Intergenic
1158389023 18:57028100-57028122 GCAAGTTTTCCGGGGGAAAGGGG - Exonic
1158455653 18:57604953-57604975 CTAAGTTTACCTGGGGCACTAGG + Intronic
1159529711 18:69639971-69639993 TCATGGTTACCTGGGGAAACAGG - Intronic
1162719904 19:12656210-12656232 ATAAATTTTCCTGGGGAAGCGGG + Intronic
1202703804 1_KI270713v1_random:6090-6112 GTTAGCTTGCCTGGGGAAAGGGG - Intergenic
928870948 2:35978477-35978499 GTAACTTTTCCTGGGTAAAAAGG - Intergenic
933306914 2:80612180-80612202 GCAAGTTTAACTTGGGACACTGG + Intronic
934025109 2:87996095-87996117 GGAAGTTTATCAGGGGGAACTGG + Intergenic
935741989 2:106157541-106157563 GTAAGTTTTCGTGTGGACACAGG - Intronic
938559921 2:132462957-132462979 GTAAGTTTACCTTGGAGAAAGGG - Intronic
943180479 2:184534570-184534592 TAAAGTTTACCTTGGGAAATAGG + Intergenic
943181422 2:184547399-184547421 GTAACTATACATGGGTAAACAGG - Intergenic
943488829 2:188523317-188523339 GTAAGTAGCCATGGGGAAACTGG + Intronic
943559130 2:189440672-189440694 GTAAGTTTACAAAGGAAAACTGG + Intergenic
943852656 2:192746083-192746105 GTAAGTTTATATGAGTAAACAGG + Intergenic
946535014 2:220618078-220618100 ATAAGTTTACCTGGGCATATTGG - Intergenic
1168932718 20:1636839-1636861 GTGAGCTCTCCTGGGGAAACAGG - Intronic
1169436077 20:5592197-5592219 GAAAGTTTACCTGAGGATCCTGG - Intronic
1172017575 20:31887127-31887149 GTAAGTTAACCTGGGAAAACAGG + Intronic
1184427267 22:44418391-44418413 GTAAGTTTACAGTGAGAAACCGG - Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950058372 3:10047592-10047614 GTATGATTGCATGGGGAAACTGG + Intronic
951152126 3:19303220-19303242 TGAAGTTTATCTGTGGAAACTGG + Intronic
952769038 3:36980650-36980672 GTAAGTGTTACTGGGAAAACTGG - Intergenic
953133375 3:40161937-40161959 GTGAGGTGACCTGGGGACACAGG - Intronic
955046160 3:55362194-55362216 GCAAATTTACCTGGGGATAAAGG + Intergenic
956564500 3:70620533-70620555 GTAACTTTAACGGGGGAAACAGG + Intergenic
964555940 3:157938726-157938748 ATAAGTGTACCTTGGGAAATAGG + Intergenic
967896757 3:194401655-194401677 GGAGGTTTTCCTGGGGAAATAGG - Intergenic
971630101 4:28980037-28980059 GTAAATTTTCCTGGGAAAAATGG + Intergenic
973051303 4:45601415-45601437 GTCAGATCACCTGGGGACACTGG + Intergenic
974624659 4:64408826-64408848 GTAATTTTACCTGTGGACAATGG + Intronic
974977213 4:68905917-68905939 GGCAGTTAACCTGGGGAAAGCGG + Intergenic
975578945 4:75889934-75889956 GTAAGCTCACCTGGGGAACCTGG - Intronic
980582911 4:134775700-134775722 GTAAGTTGAAATGGGGAAGCTGG - Intergenic
983138138 4:164111214-164111236 TTGATTTTACCTGTGGAAACTGG - Intronic
986032602 5:3908485-3908507 GAAAGTGAACCTGGGGACACAGG - Intergenic
986131555 5:4936561-4936583 GTTTGTTTACCTGGAGAAATTGG - Intergenic
986141015 5:5029961-5029983 GTAAGTGGTGCTGGGGAAACAGG + Intergenic
995326174 5:110892659-110892681 GTAATAACACCTGGGGAAACAGG - Intergenic
995369603 5:111404393-111404415 GTAATTATAGCTGGTGAAACAGG + Intronic
995859867 5:116629730-116629752 TTAAGTTTACCTAGGAAAACAGG + Intergenic
996116013 5:119619501-119619523 GTAAGTCGTGCTGGGGAAACTGG - Intronic
996507832 5:124287955-124287977 ATAAGTCCAGCTGGGGAAACAGG + Intergenic
997756441 5:136404040-136404062 GGAAGTTAATTTGGGGAAACTGG - Intergenic
998897673 5:146817253-146817275 GAATGTTTACCTTGGGAAAGAGG - Intronic
1000386478 5:160679139-160679161 GTAGGTTTCCCTGAGGACACAGG + Intronic
1001021223 5:168183986-168184008 GTCAATTCACCTGGGGAACCAGG + Intronic
1001083284 5:168682357-168682379 GGAAGTTTTCCTTTGGAAACTGG + Intronic
1003704148 6:8505752-8505774 GGAAGTCTACCTGGTGAGACTGG - Intergenic
1003815870 6:9839611-9839633 ATCAGGTTACCTGGAGAAACAGG - Intronic
1004284370 6:14306948-14306970 GAAAGCTCTCCTGGGGAAACTGG + Intergenic
1009265099 6:61544540-61544562 CTAGGTTTAACTGGGGAAAGTGG + Intergenic
1013668394 6:112371751-112371773 GAAAGTTTGCATGGGGTAACAGG + Intergenic
1018324121 6:162646192-162646214 GTGATTTTACCTGGGAAAACTGG - Intronic
1020636013 7:10696421-10696443 GACAGAGTACCTGGGGAAACGGG + Intergenic
1028165943 7:87538685-87538707 GAATGTTTTCCTGGGGAAATGGG - Intronic
1034007488 7:147490171-147490193 GTAATGTTTCCAGGGGAAACAGG + Intronic
1034287192 7:149894163-149894185 GTAAATGTTACTGGGGAAACTGG + Intergenic
1034990338 7:155544025-155544047 TTAAGTTTGCCTGGAGAAAATGG - Intergenic
1035006949 7:155671010-155671032 GTCAGTTTGCCCTGGGAAACTGG + Intronic
1037080602 8:14780577-14780599 TGAAGTTTTCCTGGAGAAACAGG + Intronic
1040857724 8:51967433-51967455 GTAATTTTACCATAGGAAACTGG + Intergenic
1046388730 8:113539998-113540020 GTAACTTTATTTGGGTAAACTGG + Intergenic
1046981635 8:120342683-120342705 TTAAATTTACATGGGCAAACAGG - Intronic
1053416227 9:37948527-37948549 GCAAGTTTCCCAGGGGACACTGG + Intronic
1054730796 9:68701135-68701157 GTAAGGTTCCCAGGGTAAACTGG + Intergenic
1055762001 9:79618961-79618983 CTTATTTTACCTGGGGAAAAGGG + Intronic
1058248707 9:102664277-102664299 GTAAATTGTCCTGGGAAAACTGG - Intergenic
1060853918 9:126899881-126899903 GTAACTTTACGTGGTGAAAGAGG + Intergenic
1185644342 X:1606545-1606567 GAAAGTTTACCTGGTGAGGCTGG - Intergenic
1186620995 X:11240158-11240180 GTAAGTTTACATAGGAAAACAGG + Intronic
1192325082 X:70124895-70124917 TTGAGATTACTTGGGGAAACAGG + Intergenic
1192908626 X:75579398-75579420 TCAAGTTTACTTGGGGACACAGG + Intergenic
1193910722 X:87302934-87302956 GTAAATGTTGCTGGGGAAACTGG - Intergenic
1193990659 X:88302719-88302741 TTAATATTACTTGGGGAAACTGG - Intergenic
1196100358 X:111841340-111841362 GTACTTTTACCTAGGGATACAGG - Intronic
1196185377 X:112739823-112739845 TTATTTTTACCTGGGGAAAAGGG + Intergenic
1197728867 X:129793940-129793962 CTAAGTGTCCCTGGGGAAGCAGG - Exonic
1198006509 X:132499969-132499991 GTAAGTTTCCTGGGGGATACAGG - Intergenic
1199753271 X:150841342-150841364 GGAAGTTTACACAGGGAAACTGG + Intronic
1200056689 X:153465243-153465265 GGAAGTTTACCTCGGAAATCTGG + Intronic
1201422245 Y:13812313-13812335 GAAAGAGTACCTGGGGAAAGGGG - Intergenic