ID: 1115694218

View in Genome Browser
Species Human (GRCh38)
Location 14:35879045-35879067
Sequence CTCTGTGACCGTGAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115694214_1115694218 -8 Left 1115694214 14:35879030-35879052 CCAACATCACGGCCACTCTGTGA 0: 1
1: 0
2: 0
3: 10
4: 93
Right 1115694218 14:35879045-35879067 CTCTGTGACCGTGAGGAAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115694218 Original CRISPR CTCTGTGACCGTGAGGAAGT GGG Intronic
900659903 1:3777097-3777119 CTCTGTGCCCGTGAGGATAGTGG - Intergenic
902123318 1:14186628-14186650 CTCTTTGACCGTGGGCAGGTAGG + Intergenic
902979576 1:20113339-20113361 CCCTTTGACCCTGAGGAGGTGGG + Exonic
903179016 1:21596261-21596283 CCCTGTGGCCGTGTGGATGTCGG - Intronic
905805527 1:40874265-40874287 CCCTGTGACCCTGTGGAAGAGGG + Intergenic
906150436 1:43584312-43584334 CTCTGTGAGGGTGAGGGAGCCGG + Intronic
906654510 1:47537837-47537859 CTCAGTGACTGTGAGAAGGTGGG - Intergenic
906661321 1:47584474-47584496 CCCTGTGGCTGTGAGCAAGTTGG + Intergenic
908348001 1:63255408-63255430 CTCAGTGACAGACAGGAAGTTGG - Intergenic
911600562 1:99843908-99843930 TTCTGTGACTGGGAGAAAGTTGG + Intergenic
914755145 1:150558111-150558133 CTCTGTGGCCATTGGGAAGTTGG + Exonic
915345603 1:155195359-155195381 CGCTGCCACCGTGAGTAAGTGGG + Intergenic
915366367 1:155319029-155319051 CTGTGTGACCTTGAGCAAGTCGG + Intronic
915923880 1:160001548-160001570 CTCTGTGACAGAGATGAGGTGGG + Intergenic
916391455 1:164335329-164335351 CTGTGTGACCTTGGGTAAGTGGG + Intergenic
917631288 1:176893828-176893850 CTCTATGTCCTTGAGGACGTTGG + Intronic
920450342 1:206056116-206056138 CTCTGACACCGGGAGGAAGGTGG - Intronic
921355545 1:214281373-214281395 CTCGTTGACCGTGAGCACGTAGG - Exonic
923043800 1:230339316-230339338 CTCAGTGTCAGTGAGGATGTAGG + Intronic
924204983 1:241703153-241703175 CCCGGTGACGGTGAGGTAGTTGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1064716426 10:18181417-18181439 CTCTCTGCCCGTAAGGAACTTGG + Intronic
1068040268 10:51815467-51815489 CTCTCCAACCATGAGGAAGTGGG - Intronic
1068792993 10:61047802-61047824 CTCTGTGACCAATAGTAAGTTGG - Intergenic
1069905032 10:71727209-71727231 CTGTGTGACCCTGAACAAGTCGG - Intronic
1070593572 10:77817493-77817515 CTCTGTGTCCCTGAGGTTGTTGG - Intronic
1071453082 10:85818153-85818175 CTCTTTGACAGTGAGAAAGTTGG - Intronic
1072531600 10:96324548-96324570 CTGTGTGATCTTGAGCAAGTTGG + Intronic
1072755835 10:98020153-98020175 CTCTGACAGCGTGTGGAAGTGGG - Intronic
1077287510 11:1774206-1774228 CTCAGAGACAGTGAGGAGGTTGG + Intergenic
1078480200 11:11668790-11668812 CTCTGGGACCATGGGGAAGATGG + Intergenic
1079029991 11:16979455-16979477 CTGTGTGACCTTGAGCAAGGTGG - Intronic
1080583035 11:33658852-33658874 CCCTGTGTCCGTGACGCAGTTGG + Exonic
1081866523 11:46363405-46363427 CTGTGTGACTGTGTGCAAGTTGG - Intronic
1083493255 11:63028442-63028464 TCCTATGACCGTGAGGCAGTGGG - Intergenic
1086335281 11:85794521-85794543 TTTTGTGACCTTGAGAAAGTGGG - Intronic
1088798741 11:113286637-113286659 GGCTGTGAGCATGAGGAAGTAGG + Intergenic
1088995134 11:114989616-114989638 GTCTGCGGCCATGAGGAAGTGGG - Intergenic
1090704100 11:129321049-129321071 CTCTATGACCTTGGGCAAGTTGG + Intergenic
1093994408 12:25625883-25625905 GTCTGTGACCTTGAGGAACAAGG - Intronic
1096342894 12:50817154-50817176 CTGTGTGACTGAGAGGAACTTGG + Intronic
1098964158 12:76768278-76768300 CTCAGTGACCTTGAGCTAGTAGG + Intronic
1101726743 12:107394257-107394279 CTCTGTGACCCTGGGTAAGCTGG - Intronic
1104390826 12:128389405-128389427 CGCTGGGACGGTCAGGAAGTAGG + Intronic
1105734561 13:23254722-23254744 CTCTGTGCCCGTGATGGAATGGG - Intronic
1105819751 13:24069838-24069860 CGTTGTGACAGTGAGAAAGTTGG + Intronic
1106175081 13:27323320-27323342 CTCTGTGACCTGGAGGACTTGGG - Intergenic
1107868953 13:44729620-44729642 CTCAGTGGGGGTGAGGAAGTGGG + Intergenic
1112283991 13:98087838-98087860 TTCTGCTACCTTGAGGAAGTTGG - Intergenic
1113903956 13:113810977-113810999 CTCGCTGGCTGTGAGGAAGTGGG + Intronic
1114350043 14:21840102-21840124 CTCTGTGTCCTTGAAGAAGCTGG - Intergenic
1115306111 14:31935498-31935520 GTCTGTGATAGTGAGGAAGTAGG - Intergenic
1115694218 14:35879045-35879067 CTCTGTGACCGTGAGGAAGTGGG + Intronic
1117499833 14:56340451-56340473 CTCTCTGTCCTTGAGGAACTTGG + Intergenic
1118711860 14:68526024-68526046 CTCTGTGACATTGGGAAAGTTGG + Intronic
1119432441 14:74577285-74577307 CTCAGTGGCCATGAGGAAATGGG + Intronic
1120188538 14:81419299-81419321 TTGTGTGACCTTGAGAAAGTTGG - Intronic
1120204652 14:81574642-81574664 CCCTGGGACAGTGAGTAAGTAGG - Intergenic
1122598449 14:102909067-102909089 CTCAGTGAGGGTGTGGAAGTGGG + Exonic
1124902535 15:33837499-33837521 TTCTCTGACCGTGATGATGTAGG - Intronic
1125508423 15:40280580-40280602 CTCTGTGACCCAGCGGAAATAGG + Intronic
1128946746 15:71828605-71828627 CTGGGTGACCGTGATGAAGAAGG - Intronic
1129918271 15:79294207-79294229 CTCTGTGACTGTGTGAAAGAGGG - Exonic
1129952352 15:79603001-79603023 CTATGTGACCTTCAGCAAGTTGG - Intergenic
1130614789 15:85394722-85394744 CTGTGTGACCTTGAGCAGGTAGG + Intronic
1130873324 15:87990196-87990218 ACCTGTGAGCCTGAGGAAGTGGG - Intronic
1131876555 15:96813081-96813103 CTGTCTCACTGTGAGGAAGTTGG + Intergenic
1133246928 16:4455226-4455248 CTCTGTGACCATGGGCAAGCCGG - Intronic
1134476369 16:14577575-14577597 CTTTGTGAAGGTGAGGAAGGAGG - Intronic
1138516326 16:57536981-57537003 CTCTGCCACCGAGTGGAAGTGGG + Intergenic
1139589529 16:67925862-67925884 CTCTGTGGCAGTGGGGAAGGGGG + Intronic
1143673539 17:8413367-8413389 CTCTGTGCCCATGAGGCAGGCGG + Intronic
1146289610 17:31598170-31598192 CTCACTGACCCTGAGGAAGCTGG + Intergenic
1149445168 17:56707794-56707816 CTCTGTCACAGTCAGGAAGGGGG + Intergenic
1150642545 17:66959240-66959262 CTCTGTGCCCTTTAGGGAGTGGG + Intergenic
1152351216 17:79784972-79784994 CACTGTGACGGTGATGAGGTTGG - Exonic
1152516075 17:80825695-80825717 CACAGTGACCGTCAGGAAGAGGG - Intronic
1156260331 18:35440167-35440189 CTCTGTGACTCTGAGGAAAACGG + Intergenic
1157133763 18:45034127-45034149 CTCTGTGACCTTGAGCAACCTGG + Intronic
1158612280 18:58952203-58952225 CTCTGTGACCCAGGGGAACTCGG + Intronic
1158718874 18:59905749-59905771 CTCCGTGATTGAGAGGAAGTGGG - Intergenic
1161599187 19:5170511-5170533 GGCTGTGACCCTGAGGAAGGTGG + Intronic
1161787875 19:6339405-6339427 CTCTGTGACTCTGAGGACTTTGG - Intergenic
1162260458 19:9529590-9529612 CTCTGTGACTGTGAGCAATGTGG - Exonic
1162852650 19:13442677-13442699 CTCTATGACAGTGAGAATGTGGG - Intronic
1163488192 19:17601933-17601955 CTCTGCCACCCTGGGGAAGTTGG - Exonic
1165891111 19:39112730-39112752 CTGTGTGACCATGGGCAAGTCGG + Intergenic
925194667 2:1913447-1913469 CTCTGGGACAGGGAGGAAGGGGG - Intronic
925665377 2:6249360-6249382 TACTGTGCCCATGAGGAAGTGGG - Intergenic
930711735 2:54556792-54556814 CTCAGTGACCCTGTGGAGGTGGG + Intronic
931554399 2:63485082-63485104 CTCTATAATCGAGAGGAAGTGGG + Intronic
935413332 2:102788471-102788493 CTCTGTGACCTTGAGGATTCTGG + Intronic
935840080 2:107099718-107099740 CTCTGTGACTGTTAAGAATTTGG + Intergenic
938192428 2:129295908-129295930 TTATGTGACCTTGAGGAAGGAGG - Intergenic
940261191 2:151781211-151781233 CTCTGTGATCTTGGGCAAGTTGG - Intergenic
940823195 2:158380939-158380961 CTATGTGACTGTTGGGAAGTAGG - Intronic
943472690 2:188314476-188314498 CTGTGTGACCTTGGGCAAGTGGG - Intronic
944609601 2:201388721-201388743 TTGTGTGACAGTGAGGCAGTAGG + Intronic
945268012 2:207910522-207910544 CTCTGTGACCTTGGGCAAATTGG - Intronic
947134322 2:226961923-226961945 CTATGTGAACCTGAGTAAGTGGG - Intronic
1168790410 20:572328-572350 CTCTGTGATCTTGGGGAAGCTGG + Intergenic
1172125620 20:32623650-32623672 CTCTGTGGCGGTGGGGAAGAGGG + Intergenic
1172612396 20:36261747-36261769 ATCTGCGACCCTGGGGAAGTGGG - Intronic
1173642620 20:44614649-44614671 GGCTGTGAGCGTGAGGAAGCTGG + Exonic
1174187176 20:48714844-48714866 CTCTGAGACTGTGAAGCAGTAGG - Intronic
1174432057 20:50477475-50477497 TTCTGTGACCTTGAGGAGGGAGG + Intergenic
1174850377 20:53988209-53988231 CTATGTGACTCTGAGTAAGTGGG - Intronic
1175021623 20:55857218-55857240 GTCTGTGACCCTGAGGGAGATGG + Intergenic
1178307924 21:31506057-31506079 CTGTGGGACCTTGAGCAAGTTGG - Intronic
1180319056 22:11304122-11304144 CTCTGTGTCCCTGAGGGAGAAGG - Intergenic
1180588171 22:16912063-16912085 GGCTGTGACTGTGAGGAAGGAGG + Intergenic
1181032365 22:20154713-20154735 CTCTGTGTCCTTGAGTGAGTGGG + Intergenic
1181271060 22:21658624-21658646 CTGTGTGATCCTGAGCAAGTTGG + Intronic
1181511042 22:23388841-23388863 CTCTGTGTCCCTGAGTGAGTGGG - Intergenic
1181511066 22:23388921-23388943 CTCTGTGTCCCTGAGTGAGTGGG - Intergenic
1181511104 22:23389048-23389070 CTCTGTGTCCCTGAGTGAGTGGG - Intergenic
1181511151 22:23389217-23389239 CTCTGTGTCCCTGAGTGAGTGGG - Intergenic
1182299440 22:29329533-29329555 CACTGTGAATGTGTGGAAGTGGG + Intronic
1183874189 22:40764929-40764951 CTTTGAGAGCATGAGGAAGTGGG - Intergenic
1185110898 22:48899613-48899635 CCCCGTGACCGTGAGCAAGTGGG - Intergenic
952277333 3:31890053-31890075 CTTTGTGAAGGTCAGGAAGTCGG + Intronic
957320689 3:78626318-78626340 CTATCTGGCAGTGAGGAAGTTGG - Intronic
961357096 3:126346109-126346131 CCCTGTGCCAGTGAGGAAATGGG + Intronic
961451055 3:127002466-127002488 CTCTGTAACCGTGAGGAGTGAGG + Intronic
961635226 3:128329034-128329056 CACTGTGACAGTGAGCAAGGAGG - Intronic
968596945 4:1490657-1490679 ATCAGTGACCCTGAGGAAGCAGG - Intergenic
972347532 4:38205398-38205420 CTCTGTCACAGTGAAGCAGTGGG - Intergenic
976773341 4:88679262-88679284 CTCTGTGAGGGAGTGGAAGTGGG - Intronic
979695687 4:123610677-123610699 CTGTGTGACCTTGGGAAAGTTGG - Intergenic
986405860 5:7424380-7424402 CTGTGTGACTTTGAGGAAGTTGG - Intronic
986745732 5:10743052-10743074 TTCTCTGACAGTGAGGAACTCGG + Intronic
987286848 5:16465781-16465803 CTCAGTGACAATCAGGAAGTCGG - Exonic
988646843 5:33104519-33104541 GTGTGTGACTGTGAAGAAGTTGG + Intergenic
989461148 5:41699810-41699832 TTTTGTGACTGTGAGCAAGTGGG - Intergenic
992170786 5:74099837-74099859 CTCTGTGCCCAGGAGGAAATGGG + Intergenic
996879884 5:128284298-128284320 CTCTGTGACCCTGGGCAAGTTGG - Intronic
998154255 5:139775502-139775524 CTCTGGGCCTGTGAGGATGTTGG - Intergenic
998947884 5:147360562-147360584 TACTGTGACCTTGAGCAAGTTGG - Intronic
999735776 5:154511725-154511747 CTCTGTGTCCCTGAGGCACTTGG - Intergenic
1001711785 5:173784643-173784665 CTCTGGGACAGTGGGGAAGATGG - Intergenic
1005954612 6:30655215-30655237 CTCTTGGAACGTGTGGAAGTTGG - Exonic
1007262893 6:40576117-40576139 CCCCATGACAGTGAGGAAGTAGG - Intronic
1007764960 6:44154813-44154835 GTCTGTGTCCGTGAGGGCGTCGG - Exonic
1010391424 6:75342626-75342648 CTCTGGGACCATTAGGAAGGTGG + Intronic
1012918242 6:105194254-105194276 CTCTGAGATGGAGAGGAAGTAGG - Intergenic
1016833447 6:148454692-148454714 CACTGTCAGCGTGAGGAGGTGGG + Intronic
1021670790 7:23033002-23033024 CTGTGTGACCTTGATCAAGTTGG - Intergenic
1022055629 7:26731019-26731041 TTGTGTGACCGTGAGCAAATTGG - Intronic
1024365502 7:48515930-48515952 CTCTGTGGCCTGGAGAAAGTCGG - Intronic
1024757148 7:52547732-52547754 CTCTCTGACCCTGAGGCAGAGGG - Intergenic
1024864607 7:53890735-53890757 CTCTCTAACTGTGAGGAAATTGG + Intergenic
1026122919 7:67553091-67553113 CTCTATGACCTTGAGGATGAGGG + Intergenic
1031426389 7:121610578-121610600 CTCAGTGACAGAGAGGAAGCTGG - Intergenic
1032701869 7:134388566-134388588 CTCTCAGTCCGTGATGAAGTTGG + Intergenic
1033684480 7:143625684-143625706 TTCTGTGACCCTGAGGCAGAGGG + Intronic
1033687656 7:143704903-143704925 TTCTGTGACCCTGAGGCAGAGGG + Intronic
1033700131 7:143831939-143831961 TTCTGTGACCCTGAGGCAGAGGG - Intergenic
1034105404 7:148485472-148485494 CTCTGTGTCCTTTAGGAAGAGGG + Intergenic
1035698915 8:1623006-1623028 ATCTGTGACTGTGAGGAACCTGG + Intronic
1036102106 8:5798842-5798864 TTCTCTGACCGTGAGGCAGAGGG - Intergenic
1036480599 8:9135736-9135758 CTCTGCCACCCTGGGGAAGTGGG - Intergenic
1037987419 8:23298769-23298791 CTCTGGGTCCTTGAGAAAGTAGG + Intronic
1038651582 8:29408600-29408622 CTGTTTGACACTGAGGAAGTTGG + Intergenic
1038907374 8:31920668-31920690 CTGTATGACCTTGAGGATGTTGG + Intronic
1039232817 8:35467328-35467350 CTCTGGGAAGATGAGGAAGTGGG + Intronic
1039554231 8:38465652-38465674 CTCGGTCACCGAGAGGAAGGTGG + Intronic
1039864926 8:41491869-41491891 CTCTGTGACAGGGAGGACGAGGG + Intronic
1049100262 8:140574143-140574165 CTCTGTCACGGTGGGGAAGTGGG - Intronic
1049195813 8:141315134-141315156 CCCTGTGACCTTGTGGAAGGGGG - Intergenic
1049204961 8:141359374-141359396 CTCTCTGACTCTGAGGAAGAAGG - Intronic
1049246550 8:141565808-141565830 CTCTGTGAGGGTGGGGAAGGAGG + Intergenic
1049494966 8:142925647-142925669 CTCTGTGAACGTGGGGGAGCGGG + Intergenic
1050713496 9:8492923-8492945 GGCTGTGACGGTGAGGGAGTAGG + Exonic
1052054592 9:23889829-23889851 GTCTGTGAACGTGGGTAAGTGGG - Intergenic
1052560645 9:30079041-30079063 CTCTGTGACCTTGGGCAAGTGGG + Intergenic
1057217257 9:93235974-93235996 CTGTGTGCCCCTGAGGAAGTGGG + Intronic
1057758621 9:97855203-97855225 CTCTGTAAACGGGAGGAGGTGGG + Exonic
1057820525 9:98326917-98326939 CTCTATGACCCTGAGCAAGTAGG - Intronic
1057988828 9:99745796-99745818 CACTGTTACTGAGAGGAAGTAGG - Intergenic
1060391744 9:123283457-123283479 CTCTGTGGCTGTGAAGGAGTTGG + Intergenic
1062445108 9:136590333-136590355 CACAGTGACCATGAGGACGTGGG + Intergenic
1187250001 X:17588679-17588701 ATCTGTGAAAGTGAGGCAGTTGG + Intronic
1188245522 X:27832112-27832134 CTCTGTGACCTAGAGGAAAGAGG - Intergenic
1192100315 X:68257445-68257467 CTGTGTGACCTTGAACAAGTAGG + Intronic
1192448416 X:71227290-71227312 CTCTCTCACCGTGAGGGGGTGGG - Intergenic
1198194089 X:134342606-134342628 CTGTGTGACCTTGAGCAAGTTGG + Intergenic
1198720903 X:139618986-139619008 ATCTGTGACCTTGAGTAAATTGG - Intronic
1198965159 X:142220425-142220447 CTCTGTGATCTTGGGCAAGTCGG + Intergenic
1199637975 X:149831603-149831625 CACTGTGACCTTGAGGATGAGGG - Intergenic
1199665161 X:150090669-150090691 GTATGTGACCTTGAGGAAGCTGG + Intergenic