ID: 1115699718

View in Genome Browser
Species Human (GRCh38)
Location 14:35939956-35939978
Sequence GAGCAAATCCAGAATCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115699713_1115699718 10 Left 1115699713 14:35939923-35939945 CCTATGTAGAAAATAATCTGAAT No data
Right 1115699718 14:35939956-35939978 GAGCAAATCCAGAATCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115699718 Original CRISPR GAGCAAATCCAGAATCATAT TGG Intergenic
No off target data available for this crispr