ID: 1115706156

View in Genome Browser
Species Human (GRCh38)
Location 14:36000333-36000355
Sequence ACCACTGCTCATAGAGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115706156_1115706160 3 Left 1115706156 14:36000333-36000355 CCCAACCCTCTATGAGCAGTGGT No data
Right 1115706160 14:36000359-36000381 TCTTTATGAAAGACAGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115706156 Original CRISPR ACCACTGCTCATAGAGGGTT GGG (reversed) Intergenic
No off target data available for this crispr