ID: 1115708377

View in Genome Browser
Species Human (GRCh38)
Location 14:36022261-36022283
Sequence ACAGAGAGTCTCAACTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115708372_1115708377 16 Left 1115708372 14:36022222-36022244 CCTTAAGTCTTTGATGATCATGC No data
Right 1115708377 14:36022261-36022283 ACAGAGAGTCTCAACTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115708377 Original CRISPR ACAGAGAGTCTCAACTGGGA TGG Intergenic
No off target data available for this crispr