ID: 1115710629

View in Genome Browser
Species Human (GRCh38)
Location 14:36046933-36046955
Sequence ATGGGGAAGCATAATTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115710629_1115710638 7 Left 1115710629 14:36046933-36046955 CCCTCCCAATTATGCTTCCCCAT No data
Right 1115710638 14:36046963-36046985 ATCTTTTTCTCCTATACCATTGG No data
1115710629_1115710639 13 Left 1115710629 14:36046933-36046955 CCCTCCCAATTATGCTTCCCCAT No data
Right 1115710639 14:36046969-36046991 TTCTCCTATACCATTGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115710629 Original CRISPR ATGGGGAAGCATAATTGGGA GGG (reversed) Intergenic
No off target data available for this crispr