ID: 1115712572

View in Genome Browser
Species Human (GRCh38)
Location 14:36067182-36067204
Sequence CTGTGGGGGCAAAAGCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115712572_1115712582 17 Left 1115712572 14:36067182-36067204 CCAACTTGCTTTTGCCCCCACAG 0: 1
1: 0
2: 0
3: 19
4: 193
Right 1115712582 14:36067222-36067244 GCTCTGTGGCTTCTGAGGCTAGG No data
1115712572_1115712580 3 Left 1115712572 14:36067182-36067204 CCAACTTGCTTTTGCCCCCACAG 0: 1
1: 0
2: 0
3: 19
4: 193
Right 1115712580 14:36067208-36067230 GCAGGGGATGCAATGCTCTGTGG No data
1115712572_1115712583 28 Left 1115712572 14:36067182-36067204 CCAACTTGCTTTTGCCCCCACAG 0: 1
1: 0
2: 0
3: 19
4: 193
Right 1115712583 14:36067233-36067255 TCTGAGGCTAGGTCATAAGAAGG No data
1115712572_1115712581 12 Left 1115712572 14:36067182-36067204 CCAACTTGCTTTTGCCCCCACAG 0: 1
1: 0
2: 0
3: 19
4: 193
Right 1115712581 14:36067217-36067239 GCAATGCTCTGTGGCTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115712572 Original CRISPR CTGTGGGGGCAAAAGCAAGT TGG (reversed) Intergenic
901147084 1:7072611-7072633 CTGTGGAGAAAAAAGAAAGTGGG + Intronic
901730169 1:11273369-11273391 GTCCGGGGGCAACAGCAAGTGGG - Exonic
904757962 1:32779576-32779598 CTGTGGAGGCCAAAGCAATCCGG + Intronic
907408605 1:54269308-54269330 CTTTGGGGGCAAAAGAAATGGGG - Intronic
907595167 1:55713040-55713062 CTGTGTGGGCAGAACCAAGTGGG + Intergenic
909220056 1:72946454-72946476 CTGAGGGGGCAAAATCAATGAGG + Intergenic
909227711 1:73045888-73045910 CTGTTGTAGCTAAAGCAAGTGGG - Intergenic
910715628 1:90226157-90226179 CTGTAAAGTCAAAAGCAAGTTGG - Intergenic
916895892 1:169161625-169161647 CTGTGAGGCCAGAAGCAAGATGG - Intronic
917722965 1:177803516-177803538 CTGTGAGGCCAGAAGCAAGGTGG - Intergenic
919850087 1:201666683-201666705 CTGGGGGAGAAAGAGCAAGTGGG + Intronic
920056534 1:203196919-203196941 CTGTGAAGGCAGAAGCAAGCCGG - Intergenic
920199993 1:204253958-204253980 CTGTGAGGGCAAAAGCCCGCAGG + Intronic
921596485 1:217059586-217059608 CAGCAGGGGCAACAGCAAGTTGG - Intronic
922334129 1:224605359-224605381 CTGTGGGGCTAGAAGCAAGATGG - Intronic
923154150 1:231261663-231261685 CAGTGGGTGCAAAAACGAGTGGG - Intronic
923649964 1:235865077-235865099 CTGTGGTGGAAAAAGCAAAGAGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063405262 10:5788388-5788410 CTGTGGGGGAAAGAGGAAGGAGG - Intronic
1064867199 10:19894434-19894456 CTGAGGGGACAAAAGTAGGTTGG + Intronic
1067402363 10:45988422-45988444 CTGTGGGGAGAAAAGGGAGTAGG + Intronic
1070996184 10:80785182-80785204 CTTTGGGGGGAAAAATAAGTGGG + Intergenic
1071517120 10:86305563-86305585 CTGTGGAGGCAGCAGCCAGTGGG + Intronic
1073537258 10:104289045-104289067 GTGTGGGGGGAAAAGCTAGGAGG - Intronic
1074221637 10:111443923-111443945 CTGTTGGGGAAAAAGAATGTGGG - Intergenic
1075210746 10:120489048-120489070 CTGGAGGGACAAAAGGAAGTAGG - Intronic
1075301953 10:121332826-121332848 CAGTGGGGGCAAAAGTAGGCAGG + Intergenic
1075592909 10:123705396-123705418 CTGGGAGGGCAAAACCAAGAAGG - Intergenic
1077222635 11:1424349-1424371 GTGTGGGGGCAAAAGGAAGAAGG + Intronic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077496744 11:2890340-2890362 CTGTGAGGGCACAAGAAAGCAGG + Intronic
1077694530 11:4382350-4382372 CTGTGAGGCTAGAAGCAAGTCGG + Intergenic
1077864756 11:6212808-6212830 ATGTGGATGCAAAAGCAAGGTGG - Intronic
1078298719 11:10102657-10102679 TTCTGGGGGTATAAGCAAGTTGG + Intronic
1078653765 11:13219528-13219550 CTGTGGAGGCAACAGCGTGTGGG - Intergenic
1080925182 11:36748811-36748833 CTGTGTGGCCTTAAGCAAGTTGG - Intergenic
1080994255 11:37580802-37580824 CTGTGTGGGCAAAAGGAAAGAGG + Intergenic
1082019954 11:47524068-47524090 CTGTGGGGCCCAAAGCAACAGGG + Intronic
1082904478 11:58291502-58291524 CTGTGGGGGTGAAAGCAAAGAGG - Intergenic
1083297523 11:61723067-61723089 CTGTGGGGGCACCAGCAGGTTGG + Intronic
1084771430 11:71345020-71345042 CCGTGGGAGGAAAAGCGAGTGGG + Intergenic
1085129770 11:74028356-74028378 CTGGGGAGGCAAAAAGAAGTTGG + Exonic
1088144049 11:106652907-106652929 CTGTGGGGGAAAAGGTAAGCAGG - Intergenic
1088620608 11:111678792-111678814 ATGTGTGGGCAGAAGCCAGTAGG + Intronic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090288340 11:125519675-125519697 CTGTGAGGCTAAAAGCAAGATGG - Intergenic
1090700433 11:129290136-129290158 CTGTGGGGTCAAGAGCAATAGGG + Intergenic
1090878759 11:130814975-130814997 CTGTGCGGGGAAATGCAAGAAGG + Intergenic
1090911930 11:131128968-131128990 CTGTGGTGGTAACAGCAGGTTGG + Intergenic
1091010873 11:131999156-131999178 CTGAGGGTGCAGAAGCAAGGAGG + Intronic
1091192197 11:133705452-133705474 CTGTGGGGGCAACAGACAGGCGG - Intergenic
1092955333 12:13544198-13544220 TGGTGGGGGCAAAAGCATGATGG - Exonic
1096183207 12:49562387-49562409 CTGTTGAGGCAAGAGGAAGTAGG + Intronic
1096408720 12:51362173-51362195 CTGTGGGGGAGGAAGCAGGTTGG - Intronic
1098921392 12:76305426-76305448 CTGTGAGGCTAAAAGCAAGATGG - Intergenic
1099986028 12:89665409-89665431 CTGGGAGAGCAAAAGAAAGTAGG - Intronic
1101480327 12:105090475-105090497 ATGTGGGGGCAAGGGCAAGAGGG - Intergenic
1102427017 12:112851781-112851803 ATGTGGGGGCAAAATGAGGTTGG - Intronic
1103904195 12:124319129-124319151 CTGTGTGGGCAAAGGCTAGGAGG - Intergenic
1105286337 13:19007749-19007771 CAGTGGGTGACAAAGCAAGTGGG - Intergenic
1109484203 13:62997166-62997188 GTGGAGGGGCAAAATCAAGTGGG + Intergenic
1111036086 13:82676730-82676752 CTGTAAAGTCAAAAGCAAGTTGG + Intergenic
1114804884 14:25823580-25823602 CTATTTGGGCAAAAACAAGTTGG - Intergenic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1115712572 14:36067182-36067204 CTGTGGGGGCAAAAGCAAGTTGG - Intergenic
1120685771 14:87535345-87535367 TTATAGGGGTAAAAGCAAGTGGG + Intergenic
1121561659 14:94880764-94880786 CTGTGGGGGAGAATGAAAGTTGG - Intergenic
1121662983 14:95649741-95649763 CTGTGGGTGCCAAAACAAGGTGG + Intergenic
1122957277 14:105076613-105076635 CAGTGAGGGCAAAAGCAGGGAGG + Intergenic
1124554665 15:30713203-30713225 ATGTGGGAGCAAAAAAAAGTGGG - Intronic
1124676583 15:31692477-31692499 ATGTGGGAGCAAAAAAAAGTGGG + Intronic
1127126122 15:55813601-55813623 CTGAGCTGGCAAGAGCAAGTTGG - Intergenic
1128939718 15:71778285-71778307 CTTTGGGGGTAAGGGCAAGTAGG - Exonic
1130766126 15:86873230-86873252 GTGTGGGAGCAAAGGCATGTTGG + Intronic
1132369934 15:101288864-101288886 CTGCAGGGGCAAGAGCAATTTGG + Intronic
1132639021 16:968995-969017 CTGTGGAGGGAAAAGCAACCTGG + Intronic
1134193151 16:12137916-12137938 CTCTGGCGGGAAAAGCCAGTAGG + Intronic
1135330862 16:21558447-21558469 CCGTGGTGGCAAAAGGAAGGGGG + Intergenic
1136476801 16:30518553-30518575 TGGTGGGGGCAAAAGCCAGTGGG + Intronic
1139143145 16:64292681-64292703 CTGTGAGGCTAAAAGCAAGATGG - Intergenic
1142043890 16:87912941-87912963 CGGTGGTGGCTAAAGGAAGTGGG + Intronic
1145053059 17:19679190-19679212 CTGTGGCTTCAAAAGCACGTGGG + Intronic
1146279878 17:31538109-31538131 CTTTTGGGGCAGAAGCAGGTTGG - Exonic
1146601815 17:34223917-34223939 CTGTGTGAGTAATAGCAAGTGGG - Intergenic
1149314466 17:55425766-55425788 CTGTGGGCAGAAAACCAAGTAGG - Intergenic
1149324242 17:55513585-55513607 CCGAGTGGGCAAAAGAAAGTAGG - Intergenic
1151460518 17:74251657-74251679 GTGAGGGGGCAAGAGAAAGTGGG - Intronic
1151693380 17:75701201-75701223 CTGTGCCGGCAAAAGCAGGTGGG - Intronic
1152768471 17:82153476-82153498 CTGTGGGGTCAACAGCAAGAAGG - Intronic
1153027058 18:681498-681520 CTAAGGAGGAAAAAGCAAGTGGG + Intronic
1153137268 18:1930401-1930423 CTGTGGTGGCAGTAGCAGGTTGG - Intergenic
1160479310 18:79224393-79224415 CTGTGGGGTGGAAAGCAAGTGGG + Intronic
1161000646 19:1909176-1909198 CTGTGGGGGCAGATGCAGGTGGG + Intronic
1161975549 19:7606248-7606270 CTGTGGGGGCAAGCGCTAGAGGG - Intronic
1162187277 19:8915402-8915424 CTCTTGGGGCAAAAGTGAGTTGG + Intronic
1162197206 19:8994109-8994131 CTGTGGAGGAAGAACCAAGTTGG + Intergenic
1163985080 19:20938505-20938527 CTGTTGGGGCATAAGAAAGTAGG + Intronic
1164075690 19:21816148-21816170 CTCTGTGGGGATAAGCAAGTAGG - Intronic
1164565284 19:29321557-29321579 CTGTTGGCTCATAAGCAAGTAGG + Intergenic
1165397813 19:35576773-35576795 CTGTGGGGGTAAAGGCAAGCTGG + Intergenic
1166669993 19:44703995-44704017 CTGTGGGGGCAAGAGACAGAGGG - Intronic
926007532 2:9384308-9384330 CTGTGAGGCCAGAAGCAAGATGG + Intronic
927422395 2:22947351-22947373 CTATGGGGAGAAATGCAAGTTGG - Intergenic
929083689 2:38147138-38147160 ATGTGGGGGCGAAAACAAGGGGG - Intergenic
929492254 2:42407503-42407525 CTGTGGAGCCAACAACAAGTGGG + Intronic
931441111 2:62291259-62291281 CTGTGAGGCCAGAAGCAAGATGG - Intergenic
931721808 2:65072281-65072303 CTCTGGGGGTAGATGCAAGTTGG - Exonic
932305954 2:70704472-70704494 CTGTGGGGGGACAAGCACCTCGG - Intronic
933851668 2:86372348-86372370 CTGTGGGGGCAGAAGACAGCTGG + Intergenic
934331419 2:92073289-92073311 CGGTGGGGGCAAAAAGCAGTGGG - Intergenic
935156266 2:100486214-100486236 CTGTGGGGTTAGAAGCAAGATGG + Intergenic
935559677 2:104547343-104547365 CTGTGGTGACAAATGCAAATTGG - Intergenic
936659221 2:114523608-114523630 CTGTAGAGGGAAAAGGAAGTGGG + Intronic
937111901 2:119372993-119373015 CTGTGTGGGCAACAGTCAGTGGG + Intergenic
938531967 2:132196441-132196463 CTCTGGGGGAAAAAAAAAGTAGG + Intronic
939152375 2:138488136-138488158 CTGTGGGGGAAAATGAAAATAGG - Intergenic
940069405 2:149668755-149668777 CTGTTGGGGGAAATGCAAATTGG - Intergenic
941341884 2:164316059-164316081 CTGTAGGGGCACAATAAAGTAGG + Intergenic
942458262 2:176152243-176152265 CTGTGGGCGCAAAAGGGGGTGGG + Intronic
944083065 2:195811855-195811877 CTGTGAGGCCAGAAGCAAGATGG - Intronic
945325394 2:208476331-208476353 CTCTGGGGGAAAAATCAATTTGG - Intronic
947243979 2:228026601-228026623 CAGGGAGGGCCAAAGCAAGTTGG - Intronic
947794506 2:232885541-232885563 CTTGTGGGGCAAAGGCAAGTGGG + Intronic
1170417394 20:16159075-16159097 CTGTAGGGGGAGAAGGAAGTGGG - Intergenic
1173597045 20:44265257-44265279 CTGTGGGAGCAAAAGCATGGAGG - Intronic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1175454582 20:59102265-59102287 CTGTGGGGACTAGAGCCAGTTGG + Intergenic
1175936387 20:62516044-62516066 CTGTGTGGGCACCAGCAAGGTGG - Intergenic
1182300347 22:29333545-29333567 CTGTGGAGGCAAAAATAAGGGGG + Intronic
1184200718 22:42967371-42967393 CTTAGGGGGCAAAATAAAGTTGG - Intronic
950283266 3:11724957-11724979 CTATGGGGGCAAAAGCTAAAAGG - Intergenic
952870003 3:37890634-37890656 CTGTGGTGGCAAAAGCTTCTTGG - Intronic
954750547 3:52811084-52811106 CTATGTGGGCAAAAGCTAGGTGG + Intergenic
955599001 3:60624159-60624181 GTGTGAAGGCAAAAGCCAGTAGG + Intronic
955714213 3:61811401-61811423 CTGTGGGACCAAAAGCAAGAGGG - Intronic
958171934 3:89948921-89948943 CAGTGGTGGCTAAAGCAGGTGGG - Intergenic
960737960 3:120801239-120801261 CTGTGGAGGTAAAGGCAAGTGGG + Intergenic
961081341 3:124031884-124031906 CTCTGGGGGCCAAGGCAACTGGG - Intergenic
962628223 3:137248692-137248714 TTATGGGGGCAAAGGCAAGCTGG - Intergenic
964427795 3:156571406-156571428 CTGTGTGGACCAAAGGAAGTAGG + Intergenic
964597940 3:158457836-158457858 CTATGGGGGCAAAAGCTGGTGGG + Intronic
966476524 3:180354609-180354631 CTGTGGGGACAAAGGCAAAATGG - Intergenic
967294709 3:187953747-187953769 CTGTGGGAGTTAAAGCCAGTGGG - Intergenic
967319860 3:188184579-188184601 GTGTGGTGGGAAAAGCAGGTCGG + Intronic
967798765 3:193630155-193630177 CTGTGAGGAGACAAGCAAGTTGG - Intronic
969942830 4:10751939-10751961 CTGGAGGTGCAAAAGCAAATGGG + Intergenic
970612708 4:17740376-17740398 CTGTGGAGTCATAAGCAAATGGG + Intronic
971230365 4:24796305-24796327 CTGTGGGAGAAGAATCAAGTTGG + Intronic
971290029 4:25328943-25328965 TTTTGGAGGCCAAAGCAAGTGGG + Intronic
971729642 4:30361066-30361088 TGGTGGGGGAAGAAGCAAGTGGG + Intergenic
972137445 4:35909165-35909187 CTGTAAGATCAAAAGCAAGTTGG - Intergenic
976094934 4:81498487-81498509 CTGTGGGGACAAAACCAGCTGGG - Intronic
977617636 4:99104061-99104083 CTGTGGGTGCTAGGGCAAGTGGG + Intergenic
980321655 4:131287717-131287739 TTCTGTGGGCATAAGCAAGTTGG - Intergenic
980793508 4:137650697-137650719 TTGTGAGGGCAAGAGCAATTTGG + Intergenic
981526860 4:145715353-145715375 CTGTGGGGTGAGAAACAAGTGGG + Intronic
984204780 4:176773369-176773391 CTGTAGTGGCTAAAGCAAATTGG - Intronic
985100482 4:186453257-186453279 CTGTGGGGCTAGAAGCAAGATGG + Intronic
987006714 5:13717780-13717802 ATGTGGGGGTAAAATCAAGCTGG + Intronic
997048682 5:130351861-130351883 CTGTGAGTTCAAAAGCAATTAGG + Intergenic
997964408 5:138346007-138346029 CTGTGAGGGCTGAAGCAAGATGG + Intronic
999283960 5:150382989-150383011 CTGAGGGGGAAACAGCCAGTAGG - Intronic
1000835666 5:166150681-166150703 CTGTGGAGGCAAAAAAAAGGAGG + Intergenic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1003651081 6:7961041-7961063 CTGTGGGGTGAAGAGCAAGCAGG - Intronic
1004000594 6:11593622-11593644 CTCTGGGGGCTAAGGCAAGGAGG - Intergenic
1005809761 6:29506684-29506706 GTGTGGGGGCAACAGCACCTGGG - Intergenic
1006729671 6:36227535-36227557 CCCTGAGGGCAAAAGCAAGGTGG - Intronic
1006980203 6:38141716-38141738 ATGGGGAGGTAAAAGCAAGTGGG + Intronic
1007287879 6:40761252-40761274 CTGTGAGGGAAAAAGCATGGTGG + Intergenic
1007905562 6:45457079-45457101 AGGAGGGGGCAAAAGTAAGTAGG + Intronic
1008103412 6:47416897-47416919 CTGTGAAGCCAAAAGCAAGATGG + Intergenic
1008513425 6:52298084-52298106 CTGTGTGAGCAAAGGCAATTGGG - Intergenic
1011043567 6:83057605-83057627 CTGTGGGTGGAAAAGAAAGAAGG + Intronic
1011697119 6:89922490-89922512 CTGGGTGGGCAACAGCAGGTAGG - Intergenic
1011853585 6:91661065-91661087 TTGTGGGAGAAAAAGAAAGTGGG + Intergenic
1016737854 6:147499724-147499746 GTTTGGGGGGAAAAGCAAGATGG - Intergenic
1024987114 7:55205095-55205117 CTGTTGCTGCAAAAGAAAGTGGG - Intronic
1025222410 7:57125450-57125472 CTGTGGGGGGATATGCAAGCAGG - Intronic
1025266523 7:57463716-57463738 CTGTGGGGGAATATGCAAGCAGG + Intronic
1025633194 7:63297117-63297139 CTGTGGGGGGATATGCAAGCAGG - Intergenic
1025649502 7:63451066-63451088 CTGTGGGGGGATATGCAAGCAGG + Intergenic
1025719223 7:63994550-63994572 CTGTGGGGGGATATGCAAGCAGG + Intergenic
1025720460 7:64006873-64006895 CTGTGGGGGGATATGCAAGCAGG + Intergenic
1025878566 7:65509915-65509937 CGGTGGGGGCAAAAAGCAGTGGG + Intergenic
1026128927 7:67604603-67604625 CTGTGAGGTTAAAAGCAAGATGG - Intergenic
1026997103 7:74624650-74624672 GTGTGGTGGGAAAATCAAGTGGG + Intergenic
1031073461 7:117189298-117189320 CTGTTGGAGAAAAAGAAAGTAGG - Intronic
1032951555 7:136920573-136920595 CTGTAAGGGCAAAAGGCAGTAGG - Intronic
1034836141 7:154352942-154352964 GTGTGGAGGCAGAAGCAAATTGG - Intronic
1037433519 8:18839460-18839482 TTGTGGGAGGAAAAGCAAATGGG - Intronic
1038214870 8:25552299-25552321 CTGAGGGGTCAGAAGGAAGTGGG + Intergenic
1038322265 8:26538468-26538490 CTGTGGGGGAAAAAGGGAGCGGG + Intronic
1039583120 8:38683010-38683032 CTGTGGAGGAAAAAACAAGGCGG + Intergenic
1039600126 8:38829514-38829536 ATGTGGGAGCAAAAGCATGCTGG - Intronic
1040855982 8:51948302-51948324 CTGGGAGGGCAGAAGCAAGATGG + Intergenic
1040909417 8:52502901-52502923 CTGTGGGGAAAACAGCAATTAGG - Intergenic
1041256744 8:55985306-55985328 ATGTGGGGGCAAGAGCAGGTGGG - Intronic
1047527019 8:125642167-125642189 CTGTGGGAGCACAAGGAAGGAGG - Intergenic
1047625575 8:126652754-126652776 CTGTGGGGGCAAGAGAAAGAAGG - Intergenic
1049950013 9:634741-634763 CTGTGAGGCCAGAAGCAAGATGG + Intronic
1053275537 9:36780575-36780597 CTGCAGGGGGAAAAGCAAGGGGG - Intergenic
1053286201 9:36850964-36850986 CTGTGGGGGCAGAAGGCAGGTGG + Intronic
1055676949 9:78672977-78672999 CTGTGGTGGCAATAGCAATAGGG - Intergenic
1056570194 9:87808097-87808119 CAGAGGGGGCAAATGCAAGTGGG + Intergenic
1060284903 9:122241848-122241870 CTGTAGCAGCAAAAGCAAATTGG - Exonic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1190924983 X:54894788-54894810 CTGTGGTGGTAATAGCAAGTTGG - Intergenic
1191133603 X:57040900-57040922 CTGTGGGTGCAGAAGTAAGCAGG + Intergenic
1192682800 X:73268950-73268972 CAGTGGTGGCTAAAGCAGGTGGG - Intergenic
1192911233 X:75606765-75606787 ATCTTGGGGCAAAAGCAAGGTGG - Intergenic
1195967876 X:110445484-110445506 CTGTGGGGGAGGAAGGAAGTGGG + Intronic
1200246107 X:154526662-154526684 CTGGGTGGGCAAAGGCAACTTGG + Intergenic