ID: 1115713219

View in Genome Browser
Species Human (GRCh38)
Location 14:36073182-36073204
Sequence ACTCCTATGCAGAAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115713219_1115713223 22 Left 1115713219 14:36073182-36073204 CCTTCTACCTTCTGCATAGGAGT No data
Right 1115713223 14:36073227-36073249 GACTAGATATGATTCTTATCTGG No data
1115713219_1115713224 29 Left 1115713219 14:36073182-36073204 CCTTCTACCTTCTGCATAGGAGT No data
Right 1115713224 14:36073234-36073256 TATGATTCTTATCTGGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115713219 Original CRISPR ACTCCTATGCAGAAGGTAGA AGG (reversed) Intergenic
No off target data available for this crispr