ID: 1115715576

View in Genome Browser
Species Human (GRCh38)
Location 14:36099338-36099360
Sequence CCTTCTGTATTGAATATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115715576_1115715582 7 Left 1115715576 14:36099338-36099360 CCCTGAATATTCAATACAGAAGG No data
Right 1115715582 14:36099368-36099390 GAAAACATCATTGGTGTCCTTGG No data
1115715576_1115715583 14 Left 1115715576 14:36099338-36099360 CCCTGAATATTCAATACAGAAGG No data
Right 1115715583 14:36099375-36099397 TCATTGGTGTCCTTGGAAAAAGG No data
1115715576_1115715581 -2 Left 1115715576 14:36099338-36099360 CCCTGAATATTCAATACAGAAGG No data
Right 1115715581 14:36099359-36099381 GGATGGAAGGAAAACATCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115715576 Original CRISPR CCTTCTGTATTGAATATTCA GGG (reversed) Intergenic
No off target data available for this crispr