ID: 1115715960

View in Genome Browser
Species Human (GRCh38)
Location 14:36104102-36104124
Sequence ATGGTGTTTGCATTCTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115715960_1115715962 1 Left 1115715960 14:36104102-36104124 CCAATGGAGAATGCAAACACCAT No data
Right 1115715962 14:36104126-36104148 CACTTTCTAGCATGATATGCTGG No data
1115715960_1115715965 9 Left 1115715960 14:36104102-36104124 CCAATGGAGAATGCAAACACCAT No data
Right 1115715965 14:36104134-36104156 AGCATGATATGCTGGTGGGTTGG No data
1115715960_1115715964 5 Left 1115715960 14:36104102-36104124 CCAATGGAGAATGCAAACACCAT No data
Right 1115715964 14:36104130-36104152 TTCTAGCATGATATGCTGGTGGG No data
1115715960_1115715963 4 Left 1115715960 14:36104102-36104124 CCAATGGAGAATGCAAACACCAT No data
Right 1115715963 14:36104129-36104151 TTTCTAGCATGATATGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115715960 Original CRISPR ATGGTGTTTGCATTCTCCAT TGG (reversed) Intergenic
No off target data available for this crispr