ID: 1115715964

View in Genome Browser
Species Human (GRCh38)
Location 14:36104130-36104152
Sequence TTCTAGCATGATATGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115715960_1115715964 5 Left 1115715960 14:36104102-36104124 CCAATGGAGAATGCAAACACCAT No data
Right 1115715964 14:36104130-36104152 TTCTAGCATGATATGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115715964 Original CRISPR TTCTAGCATGATATGCTGGT GGG Intergenic
No off target data available for this crispr