ID: 1115716837

View in Genome Browser
Species Human (GRCh38)
Location 14:36114900-36114922
Sequence CTATCAGTACATTATAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115716837_1115716840 3 Left 1115716837 14:36114900-36114922 CCTACTTTATAATGTACTGATAG No data
Right 1115716840 14:36114926-36114948 CTCAATATTTCTGGTAATAATGG No data
1115716837_1115716841 6 Left 1115716837 14:36114900-36114922 CCTACTTTATAATGTACTGATAG No data
Right 1115716841 14:36114929-36114951 AATATTTCTGGTAATAATGGTGG No data
1115716837_1115716839 -6 Left 1115716837 14:36114900-36114922 CCTACTTTATAATGTACTGATAG No data
Right 1115716839 14:36114917-36114939 TGATAGGCACTCAATATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115716837 Original CRISPR CTATCAGTACATTATAAAGT AGG (reversed) Intergenic
No off target data available for this crispr