ID: 1115729971

View in Genome Browser
Species Human (GRCh38)
Location 14:36258110-36258132
Sequence CCTTCTTCACCCTCCAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115729971_1115729973 -2 Left 1115729971 14:36258110-36258132 CCAGATCTGGAGGGTGAAGAAGG No data
Right 1115729973 14:36258131-36258153 GGTAAATTCAAAGATGCCTGAGG No data
1115729971_1115729977 29 Left 1115729971 14:36258110-36258132 CCAGATCTGGAGGGTGAAGAAGG No data
Right 1115729977 14:36258162-36258184 TTGAGTGGCTTACAAAATATGGG No data
1115729971_1115729975 14 Left 1115729971 14:36258110-36258132 CCAGATCTGGAGGGTGAAGAAGG No data
Right 1115729975 14:36258147-36258169 CCTGAGGTTTTGAACTTGAGTGG No data
1115729971_1115729976 28 Left 1115729971 14:36258110-36258132 CCAGATCTGGAGGGTGAAGAAGG No data
Right 1115729976 14:36258161-36258183 CTTGAGTGGCTTACAAAATATGG No data
1115729971_1115729978 30 Left 1115729971 14:36258110-36258132 CCAGATCTGGAGGGTGAAGAAGG No data
Right 1115729978 14:36258163-36258185 TGAGTGGCTTACAAAATATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115729971 Original CRISPR CCTTCTTCACCCTCCAGATC TGG (reversed) Intergenic
No off target data available for this crispr