ID: 1115729974

View in Genome Browser
Species Human (GRCh38)
Location 14:36258147-36258169
Sequence CCACTCAAGTTCAAAACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115729974_1115729980 13 Left 1115729974 14:36258147-36258169 CCTGAGGTTTTGAACTTGAGTGG No data
Right 1115729980 14:36258183-36258205 GGGAGCCCACATTAAAGGAAAGG No data
1115729974_1115729976 -9 Left 1115729974 14:36258147-36258169 CCTGAGGTTTTGAACTTGAGTGG No data
Right 1115729976 14:36258161-36258183 CTTGAGTGGCTTACAAAATATGG No data
1115729974_1115729979 8 Left 1115729974 14:36258147-36258169 CCTGAGGTTTTGAACTTGAGTGG No data
Right 1115729979 14:36258178-36258200 ATATGGGGAGCCCACATTAAAGG No data
1115729974_1115729977 -8 Left 1115729974 14:36258147-36258169 CCTGAGGTTTTGAACTTGAGTGG No data
Right 1115729977 14:36258162-36258184 TTGAGTGGCTTACAAAATATGGG No data
1115729974_1115729978 -7 Left 1115729974 14:36258147-36258169 CCTGAGGTTTTGAACTTGAGTGG No data
Right 1115729978 14:36258163-36258185 TGAGTGGCTTACAAAATATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115729974 Original CRISPR CCACTCAAGTTCAAAACCTC AGG (reversed) Intergenic
No off target data available for this crispr