ID: 1115729977

View in Genome Browser
Species Human (GRCh38)
Location 14:36258162-36258184
Sequence TTGAGTGGCTTACAAAATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115729971_1115729977 29 Left 1115729971 14:36258110-36258132 CCAGATCTGGAGGGTGAAGAAGG No data
Right 1115729977 14:36258162-36258184 TTGAGTGGCTTACAAAATATGGG No data
1115729974_1115729977 -8 Left 1115729974 14:36258147-36258169 CCTGAGGTTTTGAACTTGAGTGG No data
Right 1115729977 14:36258162-36258184 TTGAGTGGCTTACAAAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115729977 Original CRISPR TTGAGTGGCTTACAAAATAT GGG Intergenic
No off target data available for this crispr