ID: 1115729979

View in Genome Browser
Species Human (GRCh38)
Location 14:36258178-36258200
Sequence ATATGGGGAGCCCACATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115729974_1115729979 8 Left 1115729974 14:36258147-36258169 CCTGAGGTTTTGAACTTGAGTGG No data
Right 1115729979 14:36258178-36258200 ATATGGGGAGCCCACATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115729979 Original CRISPR ATATGGGGAGCCCACATTAA AGG Intergenic
No off target data available for this crispr