ID: 1115734834

View in Genome Browser
Species Human (GRCh38)
Location 14:36314682-36314704
Sequence CTGGAAAAGCAGAAGTAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 949
Summary {0: 1, 1: 0, 2: 2, 3: 91, 4: 855}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115734834_1115734838 9 Left 1115734834 14:36314682-36314704 CCTTCTTACTTCTGCTTTTCCAG 0: 1
1: 0
2: 2
3: 91
4: 855
Right 1115734838 14:36314714-36314736 GAACTACTTCTGGATCAAAATGG 0: 1
1: 0
2: 0
3: 14
4: 132
1115734834_1115734836 -1 Left 1115734834 14:36314682-36314704 CCTTCTTACTTCTGCTTTTCCAG 0: 1
1: 0
2: 2
3: 91
4: 855
Right 1115734836 14:36314704-36314726 GCCTTTATCTGAACTACTTCTGG 0: 1
1: 0
2: 0
3: 2
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115734834 Original CRISPR CTGGAAAAGCAGAAGTAAGA AGG (reversed) Exonic
901101284 1:6721025-6721047 CTGGGAAAACAGAACTAAGGTGG - Intergenic
902270274 1:15299362-15299384 CTGCAAAAGCAAAACTATGAGGG - Intronic
902957968 1:19939619-19939641 CTGGAAACACAGTAGTGAGAGGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903912996 1:26742226-26742248 CTGGGAAAACAGAAGTAAAATGG - Intronic
904316324 1:29667902-29667924 CTGCTAAAGCAGAAGTTAGGGGG + Intergenic
904425324 1:30419125-30419147 CTGGAAAAGGAGCAGTGAGTAGG + Intergenic
905053534 1:35073761-35073783 CAGGAAAAGCAGTTTTAAGAGGG - Intronic
905274596 1:36809029-36809051 CTGGGAAAGCAGAAGAGACAAGG - Intronic
906352468 1:45074864-45074886 CAGCAAAAGCAGTACTAAGAGGG - Intronic
906694393 1:47814431-47814453 CTGGACAAGGAGAGGTGAGAAGG + Intronic
906785331 1:48610723-48610745 CTGGGAAAGTAAAAGTTAGAGGG - Intronic
907943213 1:59108657-59108679 TTGGGAAAGCAGAAGACAGATGG + Intergenic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908439959 1:64143510-64143532 CTGGAAAAGCAAAAGCTACAGGG + Intronic
908990436 1:70081364-70081386 ATGCCAAAGCAGAAATAAGAAGG + Intronic
909220719 1:72957705-72957727 TTGGAAAAGTAGAAGAAAGTAGG - Intergenic
909385082 1:75045731-75045753 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
909587509 1:77307246-77307268 CAGCAAAAGCAGTATTAAGAAGG - Intronic
909904658 1:81179220-81179242 GGGGAAAAGCAGAAGTGAGATGG + Intergenic
910354330 1:86338745-86338767 ATTGAAAAGGAGAAATAAGATGG - Intergenic
910455691 1:87395186-87395208 CAGGAAAAGCAGCAGTGGGAGGG + Intergenic
911167919 1:94741547-94741569 CAGGAAAGGCAGAAGTTAGAAGG + Intergenic
911719147 1:101171127-101171149 CTAAAAAATCAGAAATAAGAAGG + Intergenic
911780941 1:101877585-101877607 TTGGAATAGGAGAAGAAAGAGGG + Intronic
912059256 1:105644651-105644673 CAGAAAAAGCAGTACTAAGAGGG + Intergenic
912087555 1:106028446-106028468 CTGGAAAAGGAAAGGTGAGAAGG - Intergenic
912108380 1:106309504-106309526 CAGAAAAAGCAGTTGTAAGAGGG + Intergenic
912136500 1:106665774-106665796 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
912584333 1:110748650-110748672 GAGGAAAAGAAGAAGAAAGATGG + Intergenic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
912898957 1:113627079-113627101 CAGCAAAAGCAGTACTAAGAGGG - Intronic
913042813 1:115044492-115044514 CAGGAAAAGTAGCATTAAGAAGG + Intergenic
913090386 1:115472782-115472804 CAAGAAAAGCAGACGTCAGATGG - Intergenic
913216145 1:116622125-116622147 CTGGAAAAGTAGATGTAAAATGG - Intronic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913505765 1:119515092-119515114 CTGGAAAAGAAGGAGAAAGGAGG - Intergenic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
914895945 1:151673114-151673136 CAGCAAAAGCAGTACTAAGAAGG - Intronic
916012542 1:160719026-160719048 CTGGATAAAAGGAAGTAAGAGGG + Intergenic
916248385 1:162710841-162710863 CTGGAAAGGCTGGAGTATGAAGG - Intronic
916308514 1:163367549-163367571 CTGGAACAGCAGCAGGAACATGG - Intergenic
916551577 1:165854845-165854867 CAGGAAAAACAGAAGTATAAAGG - Intronic
916616102 1:166441928-166441950 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
916923742 1:169495990-169496012 CTTGAAAATCAGAATTGAGAAGG - Intergenic
917300308 1:173566829-173566851 CAGCAAAAGCAGTACTAAGAGGG - Intronic
917371027 1:174294634-174294656 CTGGTAAATAAAAAGTAAGAAGG + Intronic
917431220 1:174971626-174971648 CTGCAAAATCAGAAGTTAGGAGG - Intronic
918219719 1:182425945-182425967 CTGAAAAAGAAAAAGAAAGAAGG + Intergenic
918225760 1:182480949-182480971 CAGCAAAAGCAGTACTAAGATGG + Intronic
918415811 1:184306879-184306901 CAGCAAAAGCAGTACTAAGATGG - Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918671341 1:187220845-187220867 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
918859139 1:189799016-189799038 ATGGAAGAGCAGCAGCAAGATGG + Intergenic
918864148 1:189872908-189872930 CTGGACAAGCAGAGGTCAGGAGG + Intergenic
919012993 1:191989187-191989209 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
919269651 1:195323397-195323419 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
919316572 1:195978550-195978572 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
919842569 1:201619826-201619848 CTGGAGAAGCAGAGGCAAGCTGG + Intergenic
920722811 1:208403402-208403424 CTGGACAAGATGGAGTAAGAAGG + Intergenic
920916751 1:210263869-210263891 GTGGTAAAGCAGGAGTAGGAAGG + Intergenic
921042995 1:211452100-211452122 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
921147355 1:212370782-212370804 CAGCAAAAGCAGTACTAAGAGGG + Intronic
921789774 1:219276772-219276794 ATGGAAAAGGAGAAGTACGGAGG + Intergenic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
921910291 1:220541281-220541303 CAGCAAAAGCAGTACTAAGAGGG - Intronic
921941945 1:220850687-220850709 CAGCAAAAGCAATAGTAAGAAGG - Intergenic
922013807 1:221622038-221622060 CCTGAAAAGCAGATTTAAGAAGG + Intergenic
922381666 1:225035546-225035568 CTGCAAAAGCAGTACTAACAGGG - Intronic
922922673 1:229319883-229319905 GGGGAAAAGGAGAGGTAAGAGGG + Intergenic
922933062 1:229404915-229404937 CTGGATAAACAGAAGTATTATGG + Intergenic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923395219 1:233555111-233555133 CTGGAAATGCAAAACTCAGAGGG + Intergenic
923638413 1:235724890-235724912 CTGGAAAATCAGCACTAAGCAGG + Intronic
923806028 1:237258956-237258978 CTGGCCAAGCAGAAGGCAGAAGG - Intronic
923878910 1:238082280-238082302 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
924618117 1:245632181-245632203 CAACAAAAGCAGTAGTAAGAGGG - Intronic
1062998014 10:1885687-1885709 CTGGAAAAGAATATGTAAAATGG - Intergenic
1063034889 10:2276653-2276675 CTGGAGAAGCAGGAGTATGGTGG - Intergenic
1063422182 10:5921756-5921778 CTGGAAAGGCAGACACAAGAAGG + Intronic
1063639117 10:7813558-7813580 CTGAAAGAGCAGATGCAAGATGG + Intergenic
1063730124 10:8687097-8687119 GGGGAAAAGCAGAAGATAGAAGG - Intergenic
1064126031 10:12661068-12661090 GTTGAAAAGCAGAAGGAATAGGG - Intronic
1064205378 10:13319593-13319615 CTGGGAAAGCTGAAGTGGGAGGG - Intronic
1064292319 10:14047244-14047266 GTGGAAAAGAAGAACCAAGAAGG + Intronic
1064314396 10:14241533-14241555 CTTGGAAAGCAGAAGTACAATGG + Intronic
1065208003 10:23375306-23375328 CTGGGAAGCCAGAAGCAAGATGG + Intergenic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065460238 10:25954204-25954226 CTGTAAAAGCAGTATTAATAAGG + Intronic
1066454117 10:35558289-35558311 CTGGGAAAGAAGAAGCCAGAAGG + Intronic
1067132858 10:43581567-43581589 CAGAAAAAGCAGTACTAAGAGGG - Intergenic
1067578733 10:47425795-47425817 CTGGAAAATCAGAGGTAACTAGG + Intergenic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1068103660 10:52587728-52587750 CAGAAAAAGCAGTACTAAGAGGG - Intergenic
1068439522 10:57032888-57032910 CTGTAAAATCAAAAGCAAGATGG - Intergenic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1068563149 10:58540114-58540136 CAGCAAAAGCAGTAGTAAGAGGG + Intronic
1068623785 10:59216537-59216559 AAGAAATAGCAGAAGTAAGAAGG - Intronic
1068823112 10:61401374-61401396 CTGGAAATGCAGATTTAATAGGG + Intergenic
1069859359 10:71460856-71460878 CAGGAAGAGCAGAAGTGAGTGGG + Intronic
1070221032 10:74444953-74444975 TTAGAAAAGAAGCAGTAAGAAGG + Intronic
1070247032 10:74742531-74742553 CTTGCAAAGCAGAAGGAAAAAGG + Intergenic
1070269434 10:74938471-74938493 GTGGAAAAAGAGAAGAAAGAAGG + Intronic
1070889766 10:79934445-79934467 CTAGAAAAGCAAACGTCAGAGGG + Intergenic
1071477849 10:86040087-86040109 CTGAAAAAGCAGAGTTAAGATGG + Intronic
1071950238 10:90695818-90695840 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
1072438133 10:95431947-95431969 CTGGAAAAGCAGAGGTGGGGAGG - Intronic
1072772001 10:98149493-98149515 CAGCAAAAGCAGCGGTAAGAGGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1074284615 10:112086397-112086419 CTGGAGAAGCTGAGGCAAGAAGG + Intergenic
1074626480 10:115193849-115193871 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1075101279 10:119507912-119507934 CTGGAAAAGCAGAGATGAGGTGG - Intronic
1075315890 10:121453284-121453306 GTCGAAAAGCAGCAGAAAGATGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075588301 10:123673170-123673192 CTGGAAATGCAAAAGTCAGGGGG + Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075928563 10:126273500-126273522 CTGCAAGAGAAGAAGTAAAAGGG + Intronic
1076171576 10:128324327-128324349 CTGGAGAGTCAGAAGTCAGAGGG - Intergenic
1076517746 10:131058119-131058141 CTGGAAGAGAAGAAGGGAGAGGG + Intergenic
1077202220 11:1315852-1315874 CAGCAAAAGCAGAGCTAAGAGGG - Intergenic
1077428574 11:2501032-2501054 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1079692004 11:23430511-23430533 CAGTAAAAGCAATAGTAAGATGG - Intergenic
1079930591 11:26554952-26554974 CTGGAAAAGATGGAGTAAGAGGG - Intronic
1080122446 11:28693236-28693258 GTGGTAAAGCAGGAGAAAGAAGG - Intergenic
1080278581 11:30530662-30530684 AGGGAAAATCAGAAATAAGAAGG + Intronic
1080360088 11:31503100-31503122 CTAGGAAAGCAGGAGTAAGCTGG - Intronic
1081007151 11:37759094-37759116 GTGGAAGAGCAGAAGGAAAAAGG - Intergenic
1081032698 11:38106532-38106554 CTGGAAAAGAAAAATTAAAATGG - Intergenic
1081227911 11:40547626-40547648 TTGGAAAAGCAAAAGCAATAAGG - Intronic
1081526775 11:43933037-43933059 CCAGAAACGCAGAAGCAAGAGGG - Intronic
1081625569 11:44653340-44653362 CTGGAAAAGCAGTGGCAAGGAGG - Intergenic
1081785908 11:45747207-45747229 CTAGATCAGCAGAAGTCAGAAGG - Intergenic
1081795631 11:45817396-45817418 CTTCAAAAGCAGAAGTGAAAGGG - Intergenic
1082892765 11:58157818-58157840 CTGGAGAAGCAGACGTGAGCAGG + Intronic
1082935202 11:58648983-58649005 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1083041670 11:59693856-59693878 CAGCAAAAGCAGTAGTAAGAGGG + Intergenic
1083507290 11:63170155-63170177 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1084765043 11:71302745-71302767 CTGGAAAGGCTGAAGTGGGAGGG - Intergenic
1085194025 11:74656227-74656249 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1085308026 11:75499374-75499396 AAGGAAAAGAAGAAGAAAGAAGG - Intronic
1085799265 11:79573332-79573354 CTGGAAAATTACAGGTAAGAAGG + Intergenic
1086150074 11:83599369-83599391 CTGGATAAGCAAAAGCAAGGAGG - Intronic
1086184899 11:84001934-84001956 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1086243843 11:84727535-84727557 CTGGACAAGAAGAAGAAAGCTGG - Intronic
1086609821 11:88742384-88742406 CTGGAAAAGGAAACTTAAGACGG + Intronic
1086722020 11:90132895-90132917 CTGAAAAAGCTGAAGTTAGTTGG + Intronic
1087031583 11:93711253-93711275 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1087350356 11:97023554-97023576 CTGCAAAAGCAATACTAAGAGGG + Intergenic
1087419175 11:97898683-97898705 CTGGGAAAGAAGAGGTAACAGGG + Intergenic
1087699588 11:101420668-101420690 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1087886916 11:103492655-103492677 CTTGAAAGTTAGAAGTAAGATGG - Intergenic
1088766277 11:112982515-112982537 CTGGAAAACCAGTAGTCAGGGGG + Intronic
1088823198 11:113474221-113474243 CTTGAAGAGCAGAGGTAAGAGGG - Intronic
1089028709 11:115299701-115299723 CTTAAGAAGCAGAAGCAAGACGG + Intronic
1089199685 11:116716552-116716574 TGGGAAAAGCAGAAGTCAGATGG + Intergenic
1089868521 11:121652297-121652319 GTGCAGAAGCAGAAGTCAGAAGG + Intergenic
1090031416 11:123209746-123209768 CTGGCAATGCAGAAGTCACAAGG + Intergenic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091730364 12:2876506-2876528 CTGCAAAAGGGTAAGTAAGATGG + Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1091860798 12:3781224-3781246 ATGGAAAGGAAGAAGTAAAATGG - Intergenic
1091989081 12:4940079-4940101 CAGGAAAAGCAACACTAAGATGG + Intergenic
1092735946 12:11583042-11583064 GTGTAAAAGCAGCAGCAAGATGG - Intergenic
1093009613 12:14092135-14092157 CAGGAAAAGCAGTAATGAGAGGG + Intergenic
1093124462 12:15312036-15312058 CAGGAAAGGCAGTACTAAGAGGG - Intronic
1093166162 12:15806333-15806355 CAGCAAAAGCAGCAGTAAAAGGG + Intronic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1094118578 12:26944230-26944252 CTGGAAAAGAAGAAATAAAACGG - Intronic
1094271108 12:28616244-28616266 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1094448949 12:30563501-30563523 CAGCAAAAGCAGTAGTAAGGAGG + Intergenic
1094786753 12:33858170-33858192 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1095227874 12:39698830-39698852 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1095400642 12:41811039-41811061 CAGCAAAAGCAGTGGTAAGAGGG - Intergenic
1095899238 12:47310706-47310728 CAGCAAAAGCAGTAGTAAGAGGG + Intergenic
1096930674 12:55205199-55205221 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1097146698 12:56945397-56945419 CAACAAAAGCAGAACTAAGAGGG - Intergenic
1097493337 12:60297124-60297146 CAGGAAAGGGAGAAGTAAAATGG + Intergenic
1097714412 12:62951281-62951303 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1097770231 12:63575309-63575331 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1097791586 12:63821332-63821354 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1097810088 12:64009710-64009732 CTAGAAAAGGAGAAATTAGAAGG - Intronic
1097977520 12:65703429-65703451 CAGCAAAAGCAGTATTAAGATGG - Intergenic
1098060626 12:66557808-66557830 CAGCAAAAGCAGCACTAAGAGGG + Intronic
1098064600 12:66600541-66600563 AAAGAAAAGCAGAAGTAGGAGGG - Intronic
1098207575 12:68129009-68129031 CAGTAAAAGCAGTACTAAGAGGG - Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098373699 12:69789036-69789058 CAGAAAAAGCAGTACTAAGAGGG + Intronic
1098514759 12:71361538-71361560 CTGCAAAAGCAGTTTTAAGAAGG + Intronic
1098582657 12:72119188-72119210 CGGCAAAAGCAGTACTAAGAGGG - Intronic
1098624516 12:72646655-72646677 ATGGAAAAGCAGAAGAAAGCAGG + Intronic
1098624546 12:72647318-72647340 CAGTAAAAGCAGTACTAAGAGGG + Intronic
1098734995 12:74090458-74090480 CTGCAACAGCAGTACTAAGAAGG - Intergenic
1098837414 12:75439445-75439467 TTGGAAGATCAGAAATAAGAGGG - Intergenic
1098976494 12:76907744-76907766 ATGGCAAAGGAGAATTAAGATGG + Intergenic
1098995571 12:77115704-77115726 CTAGAAATGCAGTTGTAAGAGGG - Intergenic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1099882519 12:88483909-88483931 CAGCAAAAGCAGTAGTAAGGGGG + Intergenic
1099992549 12:89740293-89740315 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
1100090359 12:90961051-90961073 CTGGAAAATCAGCAAAAAGATGG - Intergenic
1100899125 12:99218170-99218192 TTCAAAAAGCAGAAGTTAGAAGG - Intronic
1100998872 12:100334253-100334275 CAAGAACAGCAGAAGTAAGTAGG + Exonic
1101024612 12:100588507-100588529 GGGGAAAAGCAGAACTAATAAGG + Intronic
1101226982 12:102698074-102698096 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1102698120 12:114815677-114815699 ATGGAAAAACAGAGCTAAGAAGG - Intergenic
1104143037 12:126006609-126006631 CAGGACAACAAGAAGTAAGAGGG - Intergenic
1104186315 12:126435471-126435493 ATTGAAAAGCAAAAGAAAGAAGG - Intergenic
1105219879 13:18315602-18315624 CTGGAAAAGTAGATGTAAAATGG - Intergenic
1105607001 13:21934267-21934289 CTGGTAAAGGACAAGTATGAAGG - Intergenic
1106063330 13:26317784-26317806 CAGCAAAAGCAGTAGTAAGGGGG + Intronic
1106824771 13:33508629-33508651 CTGGATAAGCTGAGGTGAGAGGG + Intergenic
1107155319 13:37159739-37159761 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1107326984 13:39254886-39254908 ATGAAAAAACAGCAGTAAGAGGG - Intergenic
1107383774 13:39885941-39885963 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
1107551860 13:41483945-41483967 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1109413738 13:62008424-62008446 CTGGAACATCAGATGTAAGAGGG + Intergenic
1109905897 13:68841250-68841272 CGGCAAAAGCAGTACTAAGAGGG + Intergenic
1110126331 13:71947519-71947541 CTGGAAAGGGATAAGTAAGATGG + Intergenic
1110362832 13:74646886-74646908 CTGGGAAAGCAGGTGTAAAATGG - Intergenic
1110486857 13:76055728-76055750 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1110501549 13:76234051-76234073 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1110560767 13:76908770-76908792 CTGGGGAAGCAGAAAAAAGATGG - Intergenic
1110995457 13:82102302-82102324 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1111030769 13:82594568-82594590 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1111176635 13:84604742-84604764 CAGCAAAAGCAGACCTAAGAGGG - Intergenic
1111356076 13:87104066-87104088 CTGCAAAAGCAGTACTAAGAGGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112849109 13:103682249-103682271 CTGGAAAAGAGATAGTAAGAAGG - Intergenic
1112913524 13:104519565-104519587 CTGATAAAGCAGTAGTAAGAGGG - Intergenic
1113198655 13:107839216-107839238 CTGGAATAGGAGCAGGAAGATGG - Intronic
1113217204 13:108055929-108055951 CTGGAAAAACAGAAATACGAAGG + Intergenic
1113316225 13:109182285-109182307 CTGGACAAACACATGTAAGATGG + Intronic
1113353755 13:109556760-109556782 CAGCAAAAGCAGATCTAAGAGGG + Intergenic
1113470498 13:110541577-110541599 CTGAAAAATGAGAAGTCAGAAGG - Intronic
1114160701 14:20163260-20163282 CAGCAAAAGCAGTGGTAAGAGGG - Intergenic
1114192070 14:20447282-20447304 GTGGAAAAACAGAAGAAACATGG + Intronic
1114326343 14:21593012-21593034 CAGGACAAGAAGAACTAAGAGGG + Intergenic
1114689753 14:24569919-24569941 CAGGAAAAGCAGTGCTAAGAAGG + Intergenic
1115196547 14:30806695-30806717 TGGGAAAAGCAGGAGCAAGAGGG + Intergenic
1115362043 14:32514791-32514813 CTGGGAAAGGATAAGTAGGAGGG + Intronic
1115368765 14:32588356-32588378 TTGCAAAAGCATAAATAAGAAGG - Intronic
1115381260 14:32742517-32742539 CAGTAAAAGCAGTACTAAGAGGG - Intronic
1115494696 14:33991661-33991683 TTGGAAAGGCAGATGTGAGATGG + Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1116058207 14:39889530-39889552 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1116062885 14:39946748-39946770 CAGCAAAAGCAGAACTAAGAGGG - Intergenic
1116287521 14:42991557-42991579 CCAGAAAAGCAGAGGTTAGACGG + Intergenic
1116401994 14:44518716-44518738 ATGGCAAAGCAGTACTAAGAAGG - Intergenic
1116957409 14:50938821-50938843 TTGGACAAACAGAAGTCAGACGG + Intronic
1118088765 14:62448641-62448663 CTGGCAAAGCAGAAGCAAACAGG - Intergenic
1118538715 14:66798963-66798985 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1118575437 14:67237751-67237773 CTGTAAAACCAGGAGTAAGGTGG - Intergenic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1118672130 14:68140284-68140306 CAGGAAAAGGAAAAGCAAGATGG - Intronic
1118896100 14:69946905-69946927 TGGCAAAAGCAGAAGCAAGAGGG - Intronic
1118953275 14:70454568-70454590 CAGGTATAGCAGAAGTAAGGGGG + Intronic
1118963271 14:70555795-70555817 TTTGAAAGGGAGAAGTAAGAGGG - Intergenic
1119256284 14:73200741-73200763 CTGGAAAAGCAGTTTCAAGAAGG + Intronic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119625935 14:76175387-76175409 TTAGAAAAGCAGAAGAGAGATGG - Intronic
1119886565 14:78148490-78148512 CTGGGAGAGCAGAAGCGAGAAGG + Intergenic
1120329617 14:83074665-83074687 CTAGAAGAGAAGAATTAAGACGG + Intergenic
1120579538 14:86228793-86228815 CTGGAAGAGCAGAACAAAGTTGG - Intergenic
1121141375 14:91545386-91545408 ATGGAAAAGAAAAAGAAAGAAGG - Intergenic
1121373878 14:93387388-93387410 CAGCAAAAGCAGAACTAAGAAGG - Intronic
1121463171 14:94097631-94097653 CTGGAGCTGCAGAAGTATGAGGG + Intronic
1121784503 14:96646444-96646466 CAGGAAAAGCAGTGCTAAGAAGG - Intergenic
1121891391 14:97594598-97594620 CTGTAAAAGCACAAATAAAAAGG - Intergenic
1121961256 14:98262367-98262389 TGGCAAAAGCAGAAGCAAGAGGG + Intergenic
1122252463 14:100449513-100449535 CTGGAAAAGCTGAGGTCAGGAGG + Intronic
1123111758 14:105873369-105873391 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1123411007 15:20059558-20059580 CTGCAAAAGCAGTACTAAGAGGG + Intergenic
1123520338 15:21066246-21066268 CTGCAAAAGCAGTACTAAGAGGG + Intergenic
1123877664 15:24639928-24639950 CTGGAAATGCAGAAATCAGTTGG + Intergenic
1124213686 15:27786749-27786771 ATGGAAAGGAAGAAGTAAAACGG - Intronic
1124601950 15:31140589-31140611 ATGGAAGAGAAGAAGCAAGAAGG - Intronic
1125387121 15:39149699-39149721 CAGGAAAATGAGAAATAAGAAGG + Intergenic
1125565410 15:40674129-40674151 CAGTAAAAGCAGTACTAAGAGGG - Intergenic
1125833166 15:42730296-42730318 TTGCAAAAGCAGAACTAAAAGGG + Intronic
1126015895 15:44349983-44350005 CAGCGAAAGCAGAACTAAGAGGG + Intronic
1126075586 15:44905993-44906015 CTGGCAAAGAAAAAGAAAGAAGG - Intergenic
1126185345 15:45825887-45825909 CCGCAAAAGCAGTAGTAAGAGGG + Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1126944034 15:53798063-53798085 TAGCAAAAGCAGAACTAAGAAGG + Intergenic
1127035457 15:54911656-54911678 CAGAAAAAGCAGCACTAAGAGGG + Intergenic
1127340236 15:58034499-58034521 CTTGAATAGCAGCAGCAAGAGGG + Intronic
1127740091 15:61895202-61895224 CAGCAAAAGCAGCACTAAGAGGG + Intronic
1129375907 15:75131458-75131480 CTGTAAAACCAGAAGTGAGATGG + Intergenic
1129573742 15:76718265-76718287 CAGCAAAAGCAGTTGTAAGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130357928 15:83152179-83152201 CTGGAAGACCAGAAGTAACTTGG - Intronic
1131059923 15:89398308-89398330 CTGGAGAAGCGTAAGTAGGAGGG + Intergenic
1131253193 15:90844300-90844322 ATGGACAAGGAGAAGTAATAAGG - Intergenic
1131619906 15:94057138-94057160 CTGTAAAAGCAAAAATCAGATGG + Intergenic
1132124196 15:99206952-99206974 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1133543578 16:6782315-6782337 CAGCAAAAGCAGTACTAAGATGG - Intronic
1135727858 16:24870838-24870860 CTAGAGATGCAGAAGAAAGATGG + Intronic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1138798722 16:60000715-60000737 CTGAAAGAGGAGAAGTGAGATGG + Intergenic
1141035093 16:80619595-80619617 ATGGAAAGGCAGTAGTGAGAGGG + Intronic
1142368778 16:89666123-89666145 CTGGAAAACCAGAGGCATGAGGG + Intronic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143296142 17:5873419-5873441 ATGGAACAGAAGAAGGAAGAAGG - Intronic
1143319029 17:6055873-6055895 AGAGAAAAGCAGAAGTAAAAGGG + Intronic
1143747797 17:9006125-9006147 CTGGAAAAGTGGAAGAAAGTGGG + Intergenic
1143936246 17:10487467-10487489 CTGAAAAAGCAGTTATAAGAGGG - Intergenic
1144457622 17:15432075-15432097 CTGGACCAGCAGAGGTAGGATGG - Intergenic
1144701110 17:17340968-17340990 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1145073447 17:19831477-19831499 TAGCAAAAGCAGTAGTAAGAGGG + Intronic
1145823275 17:27857086-27857108 CAGGAAAAGCAGAACAAAGCGGG + Intronic
1146543774 17:33720266-33720288 CTCCAGAAGCAGAATTAAGAAGG + Intronic
1146919237 17:36698834-36698856 CTGGAATGCCAGGAGTAAGAAGG + Intergenic
1147241959 17:39096329-39096351 TGGGAAAAACAGAAGTGAGAAGG + Intronic
1147401331 17:40181712-40181734 TTGGAAAAGGAGAGGTCAGAAGG + Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148660571 17:49328267-49328289 AAGGACAAGCAGAAGTCAGATGG + Intronic
1149452587 17:56761362-56761384 CTCGAAGAGCAGAAGTAGGCTGG - Intergenic
1149467188 17:56889404-56889426 CTGCAAAATGAGAAGTCAGATGG + Exonic
1149951235 17:60989029-60989051 CAGTAAAAGCAGTACTAAGAGGG - Intronic
1150446569 17:65231185-65231207 CCGGAAAAGCAGAGGTAGGGTGG + Intergenic
1150885175 17:69077159-69077181 CAGCAAAAGCAGTGGTAAGAGGG - Intergenic
1152231551 17:79116543-79116565 ATTGGAAAGCAGAAGTGAGAGGG + Intronic
1152370543 17:79885773-79885795 CTGGAAAGGAAAAAGTAAAATGG - Intergenic
1152772555 17:82179241-82179263 CAGGAAAAGCAGAGGCACGATGG + Intronic
1153062803 18:1011763-1011785 TTTGAAGAGGAGAAGTAAGAGGG + Intergenic
1153099890 18:1454999-1455021 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
1153215029 18:2811543-2811565 ATGGAAAACAAAAAGTAAGATGG + Intergenic
1153617238 18:6946304-6946326 CTGGCAAAACAGAAATTAGAGGG + Intronic
1155011419 18:21782459-21782481 CAGAAAAAGCAGTAGTAAGAGGG - Intronic
1155419310 18:25637323-25637345 CTGGAAGAGCAGAAGTTAACTGG - Intergenic
1155534180 18:26798883-26798905 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1157022469 18:43802547-43802569 CAGCAAAAGCAGTAATAAGAGGG - Intergenic
1157379347 18:47197700-47197722 CAGGAAAAGCAGTACTAAGAGGG + Intergenic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157469129 18:47974670-47974692 CAGCAACAGCAGAAGCAAGAAGG + Intergenic
1157886669 18:51374131-51374153 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1157908935 18:51597018-51597040 CTGGAATGGAAGAACTAAGATGG - Intergenic
1158060921 18:53340416-53340438 CTGCAAAAGAAGATGAAAGAAGG + Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158735874 18:60078353-60078375 CAGGAAAAGCAGTGCTAAGAGGG + Intergenic
1159095734 18:63899411-63899433 CTGGAAATTCAGAAGAATGAAGG - Intronic
1159732508 18:72047533-72047555 CAGAAAAAGCAGTACTAAGAGGG + Intergenic
1160115649 18:76076736-76076758 CTGAGAAAGCAGAAGTGAGGAGG + Intergenic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161842767 19:6692967-6692989 CTGGAGAAGCAGAAGCCCGACGG - Exonic
1162688014 19:12403899-12403921 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1162692332 19:12443692-12443714 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1163194853 19:15709701-15709723 CAGCAAAAGCAGTATTAAGAAGG + Intergenic
1163219579 19:15906606-15906628 CAGCAAAAGCAGTATTAAGAAGG - Intergenic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1164912741 19:32025921-32025943 ATGGCAAAGCAGAAGCAAGTTGG - Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1165566511 19:36733829-36733851 CAGCAAAAGCAGTATTAAGAAGG + Intronic
1166245976 19:41526128-41526150 CAGCAAAAGCAGAACTAAGAAGG + Intergenic
1166637375 19:44462457-44462479 CTGGAAAAAGAAAATTAAGAAGG - Intergenic
1167401183 19:49271070-49271092 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1167792787 19:51691503-51691525 GAGGAAAAGCAGGAGAAAGAGGG + Intergenic
1167961478 19:53107711-53107733 CTGGGAAAGAATCAGTAAGATGG - Intergenic
1168011070 19:53533144-53533166 CAGGAAAAGCAGTTCTAAGAGGG - Intronic
1168297106 19:55382832-55382854 CTAGAAAAGGAGGAGTAAGAAGG - Intronic
1168635007 19:57989365-57989387 CTGGAAAACGAGAAGGAAAAAGG + Intronic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
928244482 2:29615309-29615331 CTAGAAGAACAGAAGAAAGAGGG - Intronic
928459725 2:31459320-31459342 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
928763240 2:34609477-34609499 TAGGAAAAGCAGCACTAAGAGGG - Intergenic
928783877 2:34857912-34857934 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
929112332 2:38415399-38415421 CTGGAAGAGCAGAAGAGTGATGG - Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929810797 2:45187970-45187992 CTTGCAAAGCAGCAGGAAGAAGG - Intergenic
930415626 2:51086971-51086993 CTGGAAAAGAGGAAATAACAGGG - Intergenic
930527776 2:52551888-52551910 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
930961644 2:57268953-57268975 CAGAAAAAGCAGTAATAAGAGGG + Intergenic
930972419 2:57412136-57412158 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
931163791 2:59723254-59723276 CTGGAAAAGGAGGAGGAAGTAGG + Intergenic
931543351 2:63353816-63353838 CTGGAAAATCCGAAGTGACAAGG + Intronic
931634476 2:64329192-64329214 CGGGAAACGCAGAAGCAGGAAGG - Intergenic
931989966 2:67780187-67780209 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
932072132 2:68631260-68631282 TGGCAAAAGCAGGAGTAAGAGGG + Intergenic
932078023 2:68684342-68684364 TTGGAAAAGAAGAAGTAAAAAGG + Intronic
932085826 2:68759095-68759117 CAGAGAAAGCAGGAGTAAGAGGG + Intronic
932198115 2:69801760-69801782 CTTGCAAAGCAGAAGTAGGCTGG + Intronic
932417275 2:71581055-71581077 CTGGAAAAGCAGGCGTAAGTAGG + Intronic
932933468 2:76072970-76072992 CAGCAAAAGCAGTTGTAAGAGGG + Intergenic
933068310 2:77826993-77827015 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
933332925 2:80917605-80917627 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
933386004 2:81610982-81611004 CTCAAAAAGCAGCAGGAAGAAGG + Intergenic
933564330 2:83931264-83931286 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
933998168 2:87685169-87685191 ATAGGAAAGCAGAAGGAAGAAGG + Intergenic
934184168 2:89656914-89656936 CTGGAAAAGTAGATGTAAAATGG + Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934294456 2:91731052-91731074 CTGGAAAAGTAGATGTAAAATGG + Intergenic
934601945 2:95664336-95664358 CTATAAAAGCAGAAGTCGGATGG + Intergenic
934705553 2:96475720-96475742 CTTCAAAAGCAGAAGTTATAAGG - Intergenic
934792149 2:97070478-97070500 GTAGGAAAGCAGAAGGAAGAAGG - Intergenic
934814473 2:97313231-97313253 GTAGGAAAGCAGAAGGAAGAAGG + Intergenic
934823220 2:97395252-97395274 GTAGGAAAGCAGAAGGAAGAAGG - Intergenic
935084851 2:99835150-99835172 CGGGAAAAGGAGAAGCAAGAGGG - Intronic
935439354 2:103074146-103074168 CAGTGAAAGCAGAACTAAGAGGG + Intergenic
935518547 2:104076520-104076542 CTGGAAAAGCAAAAGAATGGAGG - Intergenic
935876919 2:107518179-107518201 TTAGAAAAGGAGAAGTAAAATGG - Intergenic
936295684 2:111265704-111265726 ATAGGAAAGCAGAAGGAAGAAGG - Intergenic
936539708 2:113340371-113340393 CTGGAAAAGGGGAAGTTAAAAGG - Intergenic
936773174 2:115939395-115939417 CTGGGATAGTAGAAATAAGAAGG - Intergenic
937494932 2:122408452-122408474 CTGGAAAGGAAGGAGCAAGAGGG + Intergenic
937570077 2:123346778-123346800 CTGGAAAAGCAGAACTTATATGG - Intergenic
938575598 2:132600240-132600262 CTGCAAAAACAGTGGTAAGAGGG + Intronic
938800098 2:134754828-134754850 CAGCAAAAGCAGTTGTAAGAGGG + Intergenic
939080231 2:137651705-137651727 CAGCAAAAGCAGTATTAAGAGGG - Intronic
939206450 2:139110651-139110673 CAGCAAAATCAGTAGTAAGAGGG - Intergenic
939244530 2:139606624-139606646 CAGCAAAAACAGTAGTAAGAGGG - Intergenic
939706822 2:145465172-145465194 CAGGAAAAGAAGAAGAAAGAAGG + Intergenic
940559570 2:155277950-155277972 CAGCAAAAGCAATAGTAAGATGG - Intergenic
940964949 2:159826656-159826678 CTGGACAAGAAGAACAAAGATGG + Intronic
941302757 2:163824498-163824520 CAGGAAAAGCAGTACTAACAGGG - Intergenic
941307052 2:163882929-163882951 CCTGAAAAGCAGTGGTAAGAAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942260363 2:174154960-174154982 TTTGAAAGGCAGAAGTAAGAAGG - Intronic
942492111 2:176499785-176499807 CTGAACAAGCAGAAATAAGGGGG - Intergenic
942651298 2:178171188-178171210 CAGCAAAAGCAGTACTAAGATGG - Intergenic
942917021 2:181323193-181323215 CTAGAAAAGTAGTAGTGAGAAGG - Intergenic
943096801 2:183438906-183438928 CTAGAAAAGTAGAATTGAGATGG + Intergenic
943102292 2:183502444-183502466 CTGCAGAAGCAGTACTAAGAGGG - Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
944147154 2:196518142-196518164 CTTGAAAAACAGAAGAAAGGAGG - Intronic
944579981 2:201124080-201124102 CTAGAGAAGCAGTAGAAAGAAGG + Intronic
944999432 2:205332445-205332467 GTGGAAGAGGAGAAGAAAGAGGG + Intronic
945327864 2:208503808-208503830 GTTGAAAAGCAGCAGTGAGAGGG + Intronic
945378313 2:209106718-209106740 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
945475965 2:210282902-210282924 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
946076477 2:217077743-217077765 ATGAAAAAGCAGAACAAAGAGGG - Intergenic
946513749 2:220388438-220388460 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
946536968 2:220641193-220641215 CAGAAACAGCAGAAGCAAGAAGG + Intergenic
946818933 2:223610445-223610467 GTGGGAATGCAGAAGTATGAGGG - Intergenic
946984995 2:225261675-225261697 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
947295886 2:228629567-228629589 TGGGAAAAGCAGAAATAAGCAGG + Intergenic
948331829 2:237174144-237174166 TTGAAAAAGCAGAAGAAAGCTGG - Intergenic
948478460 2:238236260-238236282 CTTTAAAAGTAGAAGTAAGGAGG + Intergenic
1168744194 20:222463-222485 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1169628969 20:7603983-7604005 CTGCAAAAGCAACGGTAAGAGGG + Intergenic
1169852307 20:10065470-10065492 CTGGAAAGGCAGAAAGAAAAGGG + Intergenic
1170378173 20:15725616-15725638 ATTGAAAAGCAGTGGTAAGAGGG + Intronic
1170490459 20:16867803-16867825 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1170745758 20:19097644-19097666 GTGGAAAATCAGAAGAGAGAAGG - Intergenic
1171025640 20:21628265-21628287 CTGGCAAGCCAGAAGTAAGAGGG - Intergenic
1171157924 20:22893587-22893609 TGGCAAAAGCAGGAGTAAGAGGG - Intergenic
1173891017 20:46510415-46510437 GAGGAAAAGGAGAATTAAGATGG + Intronic
1173895911 20:46550651-46550673 GTGGAAAAGCAGAAGTGGCAGGG - Intergenic
1174785386 20:53427756-53427778 ATGGAAAGGCAGCAGTAAGTTGG - Intronic
1174831469 20:53816777-53816799 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1175809996 20:61852731-61852753 CTGGAAAAGCAGCAGAGACAGGG - Intronic
1176790168 21:13310944-13310966 CTTGAACAGCAGTAGAAAGATGG - Intergenic
1176916590 21:14633235-14633257 CTAGAGAAACAGAAGTAATAGGG - Intronic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177456568 21:21346866-21346888 TAGCAAAAGCAGTAGTAAGAGGG + Intronic
1178056820 21:28808317-28808339 TTGGAAAAGAAGAAGAAAGTTGG - Intergenic
1178196963 21:30356767-30356789 CTAGAAAAGCAGAGGTCAGTGGG + Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG + Intronic
1179049605 21:37877734-37877756 CTGGAGAGGAAGAAGTGAGAGGG - Intronic
1180124065 21:45775985-45776007 CAGCAAAAGCAGAGCTAAGAGGG - Intronic
1180686411 22:17670659-17670681 CTTGAAAAGCTGATGTAAGCCGG - Intronic
1180817484 22:18800492-18800514 CTGGAAAAGTAGATGTAAAATGG - Intergenic
1181145119 22:20840320-20840342 GTGGAAAAGAAGAAGCAAGGAGG + Intronic
1181203673 22:21234814-21234836 CTGGAAAAGTAGATGTAAAATGG - Intergenic
1183005011 22:34894107-34894129 CTGCAGAATCATAAGTAAGATGG - Intergenic
1183758749 22:39796205-39796227 CAGCAAAAGCAGTAGTAAGAGGG - Intronic
1184327830 22:43804313-43804335 CAGCAAAAGCAGTACTAAGAAGG + Intronic
1184959775 22:47920665-47920687 CGGGAAAGGCAGAAGTGAGGAGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185006908 22:48284386-48284408 CTGGGAAAGAAGAAATAAAATGG + Intergenic
1203223247 22_KI270731v1_random:60602-60624 CTGGAAAAGTAGATGTAAAATGG + Intergenic
1203267582 22_KI270734v1_random:26218-26240 CTGGAAAAGTAGATGTAAAATGG - Intergenic
949330221 3:2914146-2914168 CAGCAAAAGCAGTAATAAGAGGG + Intronic
949433476 3:4003545-4003567 CTGGGAAAGCTGCAGTAATATGG - Intronic
949944105 3:9176703-9176725 CTGTAAAAGCAGAAGCAAGTGGG + Intronic
950164350 3:10782550-10782572 ATTTAAAAGCAGTAGTAAGAAGG + Intergenic
950919874 3:16683661-16683683 CGGGAAAACCTGAAGTAGGAAGG - Intergenic
950992394 3:17453155-17453177 CAGCAAAAGCAGTAGTAAGAGGG + Intronic
951818423 3:26781804-26781826 CAGGAAAAGCAGTACTAAAAGGG - Intergenic
952119741 3:30228021-30228043 CTATAAAAGCAGAAGAAAGTAGG - Intergenic
952132358 3:30380021-30380043 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
952202421 3:31144828-31144850 CAGGGAAAACAGAACTAAGAGGG - Intergenic
952250769 3:31651252-31651274 CAGGAAAAGCAGTACTAAAAGGG + Intergenic
952405024 3:32997792-32997814 CTGGGAAAGGAGAACAAAGAAGG - Intronic
953087996 3:39691981-39692003 CAGCAAGAGCAGCAGTAAGAGGG + Intergenic
953239351 3:41134839-41134861 TTTGAAAAGCAGCAGCAAGAAGG + Intergenic
953363820 3:42324846-42324868 CTGGAGAAGCATAAGCAAGTGGG - Intergenic
953720509 3:45350726-45350748 CAGGAAAAGCACAAATATGATGG - Intergenic
953879731 3:46685447-46685469 CTGGAAAAGGAGCAGTAAAGGGG - Intronic
953978357 3:47399692-47399714 CTGGAAAAGCACAGGTCTGAAGG - Intronic
954460763 3:50625697-50625719 GTGGAAAAGGAGAAATGAGAGGG - Intronic
954776815 3:53026838-53026860 CTGGAGAGGCTGGAGTAAGATGG + Intronic
955824900 3:62935342-62935364 CTGGACAAGCAGAATTCAGAGGG - Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
956940201 3:74151427-74151449 CTGGAAAAGGAGAACAAAGTTGG + Intergenic
957364871 3:79209727-79209749 CTGGAAAAGAGGAAGTCAAATGG + Intronic
957651811 3:83016295-83016317 CTGAAAAATTAGAAGTACGAAGG - Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
957976286 3:87448838-87448860 CTTGATATGCAGAGGTAAGAAGG + Intergenic
958459706 3:94379462-94379484 CTGGAAATGCCTAAGTAAAATGG + Intergenic
958784385 3:98581672-98581694 CTGGACAGGCAGAAATAAAAGGG + Intronic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959191405 3:103116314-103116336 CAGTAAAAGCAGTAATAAGAAGG + Intergenic
959248367 3:103904963-103904985 CAGAAAAAGGAAAAGTAAGAAGG + Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959717424 3:109448299-109448321 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
959766297 3:110033574-110033596 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
959877579 3:111403194-111403216 CAGCAAAAGCAGAATTAAAAGGG - Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960214389 3:115013057-115013079 CAGCAAAAGCAGTACTAAGAGGG + Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961793108 3:129390650-129390672 CTGGAAAATCAGAAAAAAGTGGG - Intergenic
961912568 3:130334914-130334936 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
962058432 3:131899512-131899534 TTGAAAAAGCAGAAATAACATGG + Intronic
963660361 3:148118604-148118626 CAGGAAAAGCAGTTCTAAGAAGG + Intergenic
963818944 3:149866686-149866708 CAGCAAAAGCAGTATTAAGAGGG - Intronic
964327165 3:155559787-155559809 CTGGAAAACAGGAAGTAAGAAGG + Intronic
965047762 3:163600856-163600878 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
965236626 3:166133041-166133063 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
965351106 3:167612318-167612340 CAGTAAAAGCAGTACTAAGAGGG + Intronic
965380771 3:167984886-167984908 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
965708804 3:171536163-171536185 CTGGGAAAGCAGAAGCCAAATGG - Intergenic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
965993624 3:174851103-174851125 CTGCAAAAACAGTAGTGAGAGGG + Intronic
966071254 3:175881204-175881226 CAGGAAAAGGAGAAAAAAGAGGG - Intergenic
966580879 3:181561458-181561480 CTGGGAACTCAGAAGTAATAAGG + Intergenic
966632048 3:182087380-182087402 CTGCAAAACCAAAAGTAAGCAGG + Intergenic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
966974083 3:185069891-185069913 CTGGGAAAGCAGCTGCAAGAGGG - Intergenic
967340493 3:188391929-188391951 TTTGAAAGGCAAAAGTAAGATGG - Intronic
967551687 3:190802352-190802374 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
967709120 3:192685505-192685527 CTCGCAAAGCAGAACTGAGAGGG + Intronic
968315574 3:197721735-197721757 CTGCAAAAGTAGTACTAAGAGGG - Intronic
968882290 4:3307472-3307494 CTAAAAAAGTAAAAGTAAGAGGG - Intronic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
970027996 4:11644376-11644398 ATGAAAAAGAAGAAGAAAGAAGG - Intergenic
970475670 4:16420246-16420268 CAGCAAAAGCAGCACTAAGAGGG - Intergenic
970723969 4:19021020-19021042 CTGTAAAAGCAAAAGTGAGATGG - Intergenic
970765300 4:19541144-19541166 ATGGTAAAGCAGAATTCAGAAGG - Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971366683 4:25983292-25983314 CTGGAAAAGGAGCAGGAAGGAGG + Intergenic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
971491338 4:27215336-27215358 CAGGAAAAGCAGCAAAAAGAAGG + Intergenic
971996566 4:33972934-33972956 CTAGAAAAGCAGAAGATATAAGG + Intergenic
973065702 4:45789069-45789091 CTGCAAAAGCAGTACTAAGAGGG + Intergenic
973115876 4:46458361-46458383 CTGCAAAAGCAGTTTTAAGAGGG + Intronic
973327120 4:48874213-48874235 CAGCAAAAGCAGCACTAAGAGGG - Intergenic
973579532 4:52328555-52328577 CAGCAAAAGCAGTTGTAAGAGGG - Intergenic
973689763 4:53414825-53414847 CTGAAAAAGCATAAGTTGGAGGG - Intronic
973763624 4:54143673-54143695 CAGCAAAAGCAGTACTAAGAGGG + Intronic
974247092 4:59333849-59333871 GTGGAAGAGCAGAAGGAAGGAGG - Intergenic
974257614 4:59480983-59481005 CAGTAAAAGCAGTACTAAGAAGG + Intergenic
974315660 4:60277391-60277413 CAGCAAAAGCAGTTGTAAGAAGG - Intergenic
974469946 4:62305754-62305776 CAGGGAAAGCAGTACTAAGAGGG + Intergenic
974678896 4:65136211-65136233 CAGGAAAAGCAGTACTAAGAAGG + Intergenic
974877441 4:67716325-67716347 CTGGAAACGCAGAGGCATGATGG + Intergenic
975236246 4:72000233-72000255 CAGGAAAAGAGGAAGTCAGATGG + Intergenic
975285808 4:72618136-72618158 CAGGGAAAGCAAAATTAAGAGGG + Intergenic
975798958 4:78038676-78038698 CTGGGAAAGGTGGAGTAAGAAGG + Intergenic
976115983 4:81727194-81727216 TAGCAAAAGCAGAGGTAAGAGGG + Intronic
976147345 4:82055047-82055069 CTGGAAAAGCACAGGCAAAAGGG - Intergenic
976253921 4:83081433-83081455 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
976310858 4:83611734-83611756 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
976357843 4:84140861-84140883 CTGGAAAAGAAGAACAAAGTTGG + Intergenic
977134457 4:93285307-93285329 TTGCAAAAGCAGAAGTATCAGGG - Intronic
977563027 4:98552343-98552365 CTGCAAAAGCAGTACTAAGAGGG - Intronic
977855016 4:101878942-101878964 CAGCAAAAGCAGTACTAAGAGGG + Intronic
978010169 4:103671781-103671803 CAGCAAAAGCAGGACTAAGAGGG - Intronic
978059030 4:104312925-104312947 CAGAAAAAGCAGAACTAAGAGGG + Intergenic
978117420 4:105037594-105037616 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
978137941 4:105285837-105285859 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
978252273 4:106646488-106646510 CAGGAAAAGCAGTACTAAGAGGG - Intergenic
979594740 4:122522117-122522139 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
979966983 4:127087208-127087230 CTGTAAAATCAGAAGCAAGTTGG - Intergenic
980297170 4:130936028-130936050 TTGGAAAGGAAGAAGAAAGACGG - Intergenic
980718982 4:136668126-136668148 CTAGAGAAACTGAAGTAAGATGG - Intergenic
981184622 4:141786349-141786371 AGGGAAATGGAGAAGTAAGATGG + Intergenic
981517962 4:145630801-145630823 CAGCAAAAGCAGTACTAAGAGGG - Intronic
981690509 4:147503393-147503415 CAGGACAAGCAGAAGTCACAGGG + Intronic
982793887 4:159623051-159623073 ATGGAAAAGCTGAAGTATTAGGG - Intergenic
982827531 4:160019530-160019552 TTGGAAAAAGAGCAGTAAGATGG + Intergenic
983281442 4:165685761-165685783 CTGGCAAATGAGAAGAAAGAAGG - Intergenic
983306609 4:165998080-165998102 AAGGAAAAGAAGAAATAAGAAGG - Intronic
983594992 4:169456206-169456228 CAGCAAAAGCAGTACTAAGACGG + Intronic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983877560 4:172894348-172894370 CAGCAAAAGCAGTACTAAGAGGG - Intronic
984235864 4:177157905-177157927 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984248998 4:177309650-177309672 CTGTAAAAGCAGAAGAAATTGGG - Intergenic
984287597 4:177752453-177752475 CAGTAAAAGCAGTTGTAAGAGGG + Intronic
984404936 4:179316355-179316377 GTTGAAAAGCAGTGGTAAGAGGG + Intergenic
984443711 4:179806218-179806240 CAGTATAAGCAGAACTAAGAGGG + Intergenic
985232304 4:187833379-187833401 CTGGAAAGGAAGAAGTAAAATGG - Intergenic
985803420 5:2021275-2021297 CTGGAAAGGCAGAGGGCAGAGGG - Intergenic
986335750 5:6754165-6754187 CCAAAAAAACAGAAGTAAGAAGG - Intronic
986604100 5:9504432-9504454 CTAGAGATGCAGAAGTAAGCAGG + Intronic
986848857 5:11786536-11786558 CAGGAAAGGCTGAAGCAAGATGG + Intronic
987295943 5:16551491-16551513 CTGGGCAAGTAGAAATAAGAAGG - Intronic
987496318 5:18649648-18649670 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
988091681 5:26549600-26549622 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
988674830 5:33421635-33421657 CAGGGAAAGCAGAACAAAGATGG + Intergenic
988717501 5:33842638-33842660 CTGGAAAAACAGAGGAAAGTGGG + Intronic
988955967 5:36319760-36319782 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
988962689 5:36385455-36385477 CAAGAAAAACAGAAGTAACAAGG - Intergenic
989076573 5:37569943-37569965 CTGGAAATACAGAAGAAATAGGG + Intronic
989215179 5:38897767-38897789 CAGCAAAAGCAGTACTAAGAAGG - Intronic
989249551 5:39294048-39294070 CAGAAAAGGCAGTAGTAAGAGGG + Intronic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
989343186 5:40400252-40400274 CTAGAAAAGCAGAGATAAGTTGG + Intergenic
989428111 5:41319601-41319623 CAGCAAAAGCAGTACTAAGAAGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989954690 5:50343855-50343877 CTGAAAAATCACAAGGAAGAGGG - Intergenic
990004142 5:50924777-50924799 CAGCAAAAGCAGATCTAAGAAGG + Intergenic
990662187 5:58028281-58028303 CCAGAAAAGCAGAAGTTAAATGG - Intergenic
991267371 5:64737421-64737443 CTGCAAAAGCAGTACTAAAAGGG + Intronic
991394913 5:66194779-66194801 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
991601084 5:68351775-68351797 CTGGAAGACCAGAGGTAGGAAGG - Intergenic
991681496 5:69144512-69144534 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
992268925 5:75046234-75046256 CTGGAAAGGCTAAAGGAAGAAGG + Intergenic
992790179 5:80206470-80206492 TTGGAAAATCGGACGTAAGATGG - Intronic
992834207 5:80624204-80624226 CTGGCCAAACAGAAGAAAGAAGG - Intergenic
993215305 5:85015037-85015059 CAGGTAAAGCAAAAGAAAGAAGG + Intergenic
993775857 5:91994635-91994657 GTAGAAGAGCAGAAGCAAGAGGG + Intergenic
993885243 5:93408413-93408435 TGGGAAAAGCAGCAGTAACAGGG + Intergenic
994115300 5:96055145-96055167 CTGGTAAAGGAGAAGTAAAATGG - Intergenic
994577551 5:101598173-101598195 CTGCAAAAGCAGTCTTAAGATGG + Intergenic
994598289 5:101867736-101867758 ATGGAAAAACAGAAATCAGAGGG + Intergenic
994608409 5:102001899-102001921 TTGGAAAGGAAGAAGTAAAATGG + Intergenic
994821454 5:104656015-104656037 CAGCAAAAGTAGTAGTAAGAGGG + Intergenic
995171737 5:109122219-109122241 CAGCAAAAGCAGTACTAAGAGGG - Intronic
995271961 5:110230586-110230608 CAGCAAAAGCAGTATTAAGAAGG + Intergenic
996033131 5:118729005-118729027 CTGAAAGAGCAGAAGTCAGGGGG - Intergenic
996108447 5:119535704-119535726 ATGGAAAAGCACATGAAAGAAGG - Intronic
996143625 5:119946163-119946185 CAGCAAAAGCAGTGGTAAGAAGG + Intergenic
996459814 5:123728700-123728722 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
996968571 5:129335029-129335051 CTGCAAAAGCAGTACTATGAGGG + Intergenic
997251528 5:132392410-132392432 CTGGAGAAGCAAAGGAAAGAGGG - Intronic
997255137 5:132422688-132422710 TTTGAAAAGCAGATGTAAAATGG - Intronic
997452665 5:133996094-133996116 CTGGACAGACAGAAGTCAGAGGG + Intronic
999072214 5:148756747-148756769 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
999683864 5:154085051-154085073 TTGCAAAGGCAGAAGTAATAAGG + Intronic
1001642233 5:173252604-173252626 CTAGAAAAGCAGAAGAGAGAGGG + Intergenic
1002646054 5:180655780-180655802 CCGCAAAAGCAGTACTAAGAGGG - Intergenic
1003402685 6:5803949-5803971 CAGGAACAGTAGAAGTAGGAAGG + Intergenic
1003491213 6:6623553-6623575 GTGAAAAAGCAGAGGAAAGAGGG + Intronic
1003763067 6:9203867-9203889 CAGGAAAAGAAAGAGTAAGAGGG + Intergenic
1003775481 6:9356946-9356968 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1005392009 6:25343626-25343648 TTGGAAAAGCTGAAGTAAAGAGG - Intronic
1005689677 6:28290941-28290963 CTGCAAAAGCAGTACTAAGAAGG + Intronic
1005713653 6:28526189-28526211 CTGGCAAAGAAGAAGAAAGCAGG - Intronic
1005740397 6:28785782-28785804 AAGGAAAAGAAGATGTAAGAAGG - Intergenic
1006462328 6:34168694-34168716 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1006734885 6:36266541-36266563 CTGGACAATGAGAAGTAACAGGG - Intronic
1006752783 6:36389030-36389052 CTGGAAAAGCTGAGGTAAAGTGG + Intergenic
1006989402 6:38200259-38200281 CTGCAAAAGCAGTACTCAGAGGG + Intronic
1007409700 6:41654576-41654598 CTGGAGAAGCTGAAGTCAGCAGG - Intergenic
1008117682 6:47571255-47571277 CTGGCAATGCAGGAGCAAGATGG + Intronic
1008629615 6:53350582-53350604 CTGGAAAGGCAAAACTTAGATGG - Intergenic
1008858310 6:56117924-56117946 CAGCAAAAACAGTAGTAAGATGG + Intronic
1009245727 6:61234957-61234979 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1009472485 6:64045033-64045055 GTGGAAAAGGAAAAGTAAGATGG + Intronic
1009479850 6:64143110-64143132 CTGGAAAAGCAAAACTATGGAGG + Intronic
1009748385 6:67850015-67850037 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1009789398 6:68382049-68382071 CAGCAAAAGCAGAACTAAGAGGG - Intergenic
1010080869 6:71860356-71860378 CTGGAATAGAAATAGTAAGAGGG + Intergenic
1010299224 6:74240376-74240398 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1010364665 6:75035423-75035445 CTGGAAAAGCAGGAGAATGCTGG + Intergenic
1010529177 6:76945479-76945501 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1010538609 6:77063170-77063192 TTGCAAAAGCAGTACTAAGAGGG - Intergenic
1010711513 6:79180630-79180652 ATGGAAAAAAAGAACTAAGATGG - Intergenic
1011159919 6:84378085-84378107 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1011232297 6:85176294-85176316 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1011488498 6:87867639-87867661 CTGGTAGAGCATAAGTAAGCAGG - Intergenic
1011694693 6:89901678-89901700 TTCGAAAAGCAGTTGTAAGAGGG + Intergenic
1011901677 6:92305929-92305951 CAGCAAAAGCAGTACTAAGATGG + Intergenic
1012288125 6:97418496-97418518 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1012653527 6:101787449-101787471 CAGGAAAAGCAGTGTTAAGAGGG - Intronic
1012870376 6:104666150-104666172 CAGGCAAAGCAGCATTAAGAGGG + Intergenic
1013306978 6:108857543-108857565 ACTGAAAAGCAGTAGTAAGAGGG + Intronic
1013760515 6:113512136-113512158 CTGGAAAAGAGGAAGAAAGAGGG - Intergenic
1014040944 6:116824092-116824114 CAGCAAAAGCAGTACTAAGAAGG + Intronic
1014191296 6:118499840-118499862 GTTGAAAAGCAGTAGTGAGAGGG - Intronic
1014264911 6:119265736-119265758 ATTGAAAAGCAGTGGTAAGAGGG - Intronic
1015180398 6:130355744-130355766 ATGGAGAAGCACCAGTAAGAGGG + Intronic
1015585591 6:134772824-134772846 TAGCAAAAGCAGAAGCAAGATGG - Intergenic
1015587650 6:134792196-134792218 CAGCTAAAGCAGTAGTAAGAGGG + Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016381400 6:143485747-143485769 ATGGAAATGAAGAAATAAGATGG - Intronic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1016646203 6:146411379-146411401 CTGGAGCAGAGGAAGTAAGAAGG + Intronic
1017057913 6:150454458-150454480 CTGGAAAACCAGCAGGGAGAGGG + Intergenic
1017613981 6:156224700-156224722 CTGCAAAAGCAGTACTAAGAGGG + Intergenic
1017757714 6:157543723-157543745 CTGGAAAGGGAGCAGTAAAATGG + Intronic
1017979046 6:159382689-159382711 CTGGAAAACCAGAAAACAGATGG + Intergenic
1018051818 6:160015895-160015917 CAGCAAAAGCAGGAGCAAGACGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019797636 7:3063525-3063547 GAGGAGAAGCAGAAGAAAGAAGG - Intergenic
1020422829 7:8028452-8028474 CAGCAAAAGCAGCACTAAGAGGG + Intronic
1020507514 7:9011394-9011416 CAGCAAAAACAGAACTAAGAGGG - Intergenic
1020518996 7:9162867-9162889 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1021771995 7:24013284-24013306 CAGGAAAAGCAGTACTAAGAGGG + Intergenic
1022223310 7:28336843-28336865 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1022740845 7:33119815-33119837 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1023215429 7:37857558-37857580 CAGGGAAAGGAAAAGTAAGATGG + Intronic
1023468506 7:40486617-40486639 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1023570816 7:41569617-41569639 CTCTAGAAGCAGAAGCAAGAAGG + Intergenic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1024316196 7:48019288-48019310 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1024357979 7:48436667-48436689 CAGTAAAAGCAGCACTAAGAAGG - Intronic
1024490048 7:49971134-49971156 CAGCAAAAGCAGTGGTAAGAGGG + Intronic
1024768643 7:52691420-52691442 CAGGAAAATCAGAACTAAAAGGG - Intergenic
1024809531 7:53191550-53191572 CAGCAAGAGCAGAAGTGAGAGGG + Intergenic
1027656825 7:80940734-80940756 TGGAAAAAGCAGAAGAAAGAAGG + Intergenic
1027687937 7:81301266-81301288 CAAGTAAAGCAGAAGTAAAAAGG + Intergenic
1027996421 7:85430806-85430828 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1028254930 7:88583278-88583300 CTGGAAAAGATGGAGTAACAGGG - Intergenic
1028259896 7:88650158-88650180 CAGGAAAAGCAGTACTAAGTGGG + Intergenic
1028266250 7:88729930-88729952 CAGTAAAAGCAGTAGTAAGAGGG - Intergenic
1028304804 7:89249626-89249648 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1028560616 7:92171037-92171059 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1028967914 7:96823426-96823448 CTGAAAATCCAGAAGTACGAAGG + Intergenic
1028994320 7:97083626-97083648 GTGGAAGAGCAGAAGACAGAGGG - Intergenic
1029025009 7:97407186-97407208 GGGGAAAAGAAGAAGAAAGAGGG + Intergenic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1030209379 7:106981246-106981268 CAGCAAAAGCAGGAGCAAGAGGG - Intergenic
1030599343 7:111575269-111575291 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1030747974 7:113191371-113191393 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1030841661 7:114360550-114360572 CAGGAAATTCAGAAGTAATAGGG - Intronic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031096801 7:117429724-117429746 CTGAAAAAGAAGAATAAAGAAGG + Intergenic
1031098781 7:117452310-117452332 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1031280381 7:119792665-119792687 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1032133390 7:129250485-129250507 TTGGACAAGAAGAAGTAAAATGG - Intronic
1032389204 7:131544785-131544807 CTGGAAAAGCACATGCAAGCTGG + Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034271434 7:149805190-149805212 CCAGAAAAGCAGAAAAAAGATGG + Intergenic
1035139373 7:156742136-156742158 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035458732 7:159026223-159026245 CTGGAACTGAAGAAGCAAGAGGG - Intergenic
1035725434 8:1822465-1822487 CTTGATCAACAGAAGTAAGAAGG - Intergenic
1035873571 8:3162634-3162656 CTTGAAAAACAAAAGTAAGAGGG - Intronic
1038125789 8:24671408-24671430 CTGAGAAAGCAGATGTGAGAAGG + Intergenic
1038706880 8:29902585-29902607 CGGGAAAAGTGGAAATAAGATGG + Intergenic
1039436608 8:37563856-37563878 CCACAAAAGCAGAAGGAAGAAGG + Intergenic
1039647176 8:39300143-39300165 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1040049137 8:42994454-42994476 CAGCAAAAGCCGTAGTAAGAGGG - Intronic
1040463998 8:47677881-47677903 ATGCAAAAGGGGAAGTAAGAGGG + Intronic
1040648824 8:49428075-49428097 CTGGAAAAGCACAAGAGACAGGG - Intergenic
1040855982 8:51948302-51948324 CTGGGAGGGCAGAAGCAAGATGG + Intergenic
1040884079 8:52240464-52240486 CTGTTAAACCAGAAGAAAGAAGG - Intronic
1040885441 8:52258218-52258240 CTGGAAAAGAAGAACAAAGTTGG - Intronic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041311121 8:56517542-56517564 AAGGAAAAGAAGAAATAAGAAGG - Intergenic
1041465312 8:58152559-58152581 CTGGAAAAGGAAAAGCCAGAAGG + Intronic
1041873428 8:62661020-62661042 CTGGAAAAGCACTAGAAAGGTGG - Intronic
1043105960 8:76110515-76110537 GTAGAAAAACAGAAGTGAGAGGG + Intergenic
1043589959 8:81819394-81819416 ATCGAAATGCAGAAGCAAGAAGG - Intronic
1043627341 8:82278283-82278305 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1043673980 8:82925850-82925872 CTGAAGGAGCAGAAGTAAAAGGG + Intergenic
1044192732 8:89338725-89338747 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1044822293 8:96162436-96162458 ATGAAAAAGCAAAAGGAAGAAGG - Intergenic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1045752541 8:105502599-105502621 CTAGAAAAGCAAAAGTTAGTGGG + Intronic
1045877809 8:107002720-107002742 CTGCTAAAGCAGTGGTAAGAGGG + Intergenic
1046119246 8:109824625-109824647 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1046277293 8:111980718-111980740 TTGGAAAACAAGAACTAAGAAGG + Intergenic
1046498099 8:115040253-115040275 TTGAAAAAGAAGAAATAAGATGG - Intergenic
1046675725 8:117105871-117105893 CTGGAAATGCAGAAGAAATAGGG - Intronic
1047403703 8:124567624-124567646 CTGGAAAAGCACAAGAAAGAAGG - Intronic
1047460225 8:125056645-125056667 ATGAAAAGGCAGAAGTCAGAGGG + Intronic
1047614192 8:126549700-126549722 ATGGAAGAGCAGTAGTAAAATGG - Intergenic
1047947334 8:129894769-129894791 CTGGAAGAGCAAAAGGAACAAGG - Intronic
1047948934 8:129911799-129911821 CAGGAGATCCAGAAGTAAGAAGG - Intronic
1047981526 8:130188184-130188206 CTGAAAAAGCAAAGGGAAGATGG + Intronic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048272501 8:133040718-133040740 GAGGAAAAGCAAAAGTGAGAGGG + Intronic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1048646988 8:136432478-136432500 GTGCAAAAGCAGTACTAAGAGGG + Intergenic
1049490054 8:142893138-142893160 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1050119756 9:2296101-2296123 CTTGAAAAGCAGGAAGAAGACGG + Intergenic
1050121319 9:2311160-2311182 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1050260507 9:3836515-3836537 CTGGAAAAGAAGAAATCTGAAGG - Intronic
1050914268 9:11111579-11111601 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1050964848 9:11786628-11786650 CTGGAGAAGTAGAAATAATATGG - Intergenic
1051007406 9:12363139-12363161 TGGGAAAGGCAGAACTAAGAGGG - Intergenic
1051844143 9:21432751-21432773 CTGGCAAAGAAGAAGAATGAAGG - Intronic
1051997885 9:23240816-23240838 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1052072854 9:24104608-24104630 CTGTAAAAGCTGAAATATGATGG - Intergenic
1052081925 9:24216838-24216860 CTGGAAAAAAAGAAGGAAGTTGG - Intergenic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1052365603 9:27608871-27608893 CTGGACCAGCAGAACTCAGAAGG - Intergenic
1052591003 9:30494939-30494961 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
1053409319 9:37905245-37905267 CTGGAAATTCAGAAGCATGAGGG + Intronic
1053564444 9:39233714-39233736 TTGCAAAGGCAGAAGCAAGATGG + Intronic
1053589261 9:39494848-39494870 CTGAAAAAGTAATAGTAAGAAGG + Intergenic
1053830226 9:42071616-42071638 TTGCAAAGGCAGAAGCAAGATGG + Intronic
1054132706 9:61385322-61385344 TTGCAAAGGCAGAAGCAAGATGG - Intergenic
1054577037 9:66870445-66870467 CTGAAAAAGTAATAGTAAGAAGG - Intronic
1054600333 9:67115839-67115861 TTGCAAAGGCAGAAGCAAGATGG - Intergenic
1055205997 9:73731199-73731221 CTGGAAAAGTACAAGCAAGTGGG + Intergenic
1055330662 9:75179643-75179665 ATGGCAGAGCAGAAGCAAGAGGG + Intergenic
1055984563 9:82043932-82043954 TTGGAAAAGAAGAAGTAAAACGG - Intergenic
1056253544 9:84775018-84775040 TTTGAAAAGCACAAGAAAGAAGG - Intronic
1056300267 9:85232974-85232996 TTTGAAAAGCAGAAGAAATATGG - Intergenic
1056456116 9:86762644-86762666 CTTGAAAAGGAGGAATAAGAAGG + Intergenic
1056996290 9:91463337-91463359 CAGCAAAAGTAGAAGTTAGAAGG - Intergenic
1057079528 9:92162217-92162239 CTGGAAGAGAAGAAGGGAGAGGG + Intergenic
1057111954 9:92480499-92480521 CTGGAAAAGCCTAGGTAAGGAGG + Intronic
1057116374 9:92526422-92526444 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058020338 9:100079461-100079483 CTAGAAAAGCAGAACTAATAGGG - Intronic
1058144132 9:101392156-101392178 CAGCAGAAGCAGTAGTAAGAGGG + Intronic
1058363760 9:104182989-104183011 CTGGAGATGCAGAAACAAGAAGG + Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1058909290 9:109506240-109506262 CTGGAAAGGCAGCAGTAATAGGG + Intergenic
1060235119 9:121857273-121857295 CTGGTGAAGCAGGAGTCAGAGGG - Intronic
1061984402 9:134121550-134121572 ATGGGAAAGCAGAAGCAAGGTGG + Intergenic
1186651780 X:11569084-11569106 CTAGTAGAGCAGAAGAAAGAGGG + Intronic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187088867 X:16072523-16072545 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1187426480 X:19181830-19181852 CTGAAAGAGCAGAAGGGAGATGG + Intergenic
1187479899 X:19645861-19645883 CTGGAAAAATGGAAGTAGGAGGG + Intronic
1187558299 X:20374197-20374219 CTGGAAAGGCAGGAGTATGAAGG - Intergenic
1187572937 X:20523673-20523695 CTGAAAAAGCAGAACTATAAGGG + Intergenic
1187575957 X:20555547-20555569 TTGGAAAAGAAGAACAAAGAGGG + Intergenic
1187618404 X:21023788-21023810 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1187621022 X:21054977-21054999 CTGGAAAGGCTGAAGAAAAAAGG + Intergenic
1187845215 X:23528457-23528479 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1188045307 X:25419551-25419573 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1188064115 X:25636455-25636477 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
1188064680 X:25644566-25644588 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1188112771 X:26211733-26211755 CTGGAAAAGAATAATTAAAAGGG - Intergenic
1188162099 X:26816731-26816753 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1188223330 X:27566872-27566894 CAGCAAAAGCAGCACTAAGAGGG - Intergenic
1188581874 X:31723759-31723781 TTTGAAAAGCAGAAGGAAGCTGG - Intronic
1188740692 X:33776270-33776292 CAGCAAAAGCAGTAGTAAAAGGG - Intergenic
1188915654 X:35906815-35906837 CAGGGAAAGCAGTACTAAGAGGG - Intergenic
1188971951 X:36628659-36628681 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1188996376 X:36891038-36891060 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1189119308 X:38377306-38377328 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1189425005 X:40891777-40891799 ATTGAAAAGCAGTGGTAAGAGGG + Intergenic
1190718389 X:53124577-53124599 ATGGAGAAGCAGGAGTTAGAGGG - Intergenic
1190811270 X:53886682-53886704 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1190899392 X:54654668-54654690 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1191198859 X:57755728-57755750 CTACAAAAGCAGTACTAAGAGGG + Intergenic
1191829844 X:65405183-65405205 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192088360 X:68125186-68125208 CAGTAAAAGCAGTACTAAGATGG + Intronic
1192619601 X:72664909-72664931 CAGCAAAAGCAGTACTAAGAAGG + Intronic
1192725606 X:73748698-73748720 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1192759442 X:74080848-74080870 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
1193192593 X:78589696-78589718 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
1193249552 X:79272985-79273007 CTGGAAAAGAAGATGTAGGGTGG - Intergenic
1193430596 X:81398990-81399012 CTGGAAATGTTGGAGTAAGAAGG + Intergenic
1193673819 X:84422365-84422387 CAGGAAAAGCAGTATTAAGAGGG + Intronic
1193688086 X:84604165-84604187 CAGCAAAAGCAGTAGTCAGAGGG - Intergenic
1193781414 X:85706726-85706748 CAGCAAAAGCAGTAGTAAGAGGG + Intergenic
1193877600 X:86880743-86880765 CAGGAAAAGCAGTACTAAGAAGG - Intergenic
1194136816 X:90154538-90154560 CAGCAAAAGCAGAACTAAGAGGG + Intergenic
1194252133 X:91588798-91588820 CAGCTAAAGCAGAATTAAGAGGG + Intergenic
1194360676 X:92946483-92946505 CAGGAAAAGCAGTACTAGGAGGG - Intergenic
1194377799 X:93156910-93156932 CTGCAAAAGCATTATTAAGAGGG + Intergenic
1194396260 X:93390437-93390459 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1194414206 X:93590434-93590456 CTGGCGAAGGAAAAGTAAGATGG + Intergenic
1194431751 X:93816262-93816284 CAGGGAAAGCAGTACTAAGAGGG + Intergenic
1194520653 X:94915227-94915249 CAGCAAAAGCAGTAATAAGAGGG + Intergenic
1194534537 X:95089385-95089407 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1194546649 X:95243163-95243185 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1194613885 X:96077602-96077624 CAGCAAAAGCAGGACTAAGAGGG + Intergenic
1194632669 X:96304789-96304811 CAGTAAAAGCAGTACTAAGAGGG - Intergenic
1194774715 X:97948165-97948187 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1194806981 X:98341970-98341992 CTGCAACAGCAGTACTAAGAGGG - Intergenic
1194857715 X:98955058-98955080 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1194892294 X:99394957-99394979 CAGTGAAAGCAGCAGTAAGAGGG - Intergenic
1194954530 X:100163166-100163188 CAGCAAAAGCAGTAGGAAGAAGG - Intergenic
1194989641 X:100533199-100533221 CAGGAAAAGCAGTCCTAAGAGGG - Intergenic
1195009058 X:100717404-100717426 CTGGATAAGCAGGAGAACGAGGG + Intronic
1195015246 X:100772769-100772791 CAGAAAAAGCAGTACTAAGAAGG - Intergenic
1195075217 X:101320703-101320725 CAGCAAAAGCAGTAGTGAGAGGG - Intergenic
1195199779 X:102536951-102536973 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1195312618 X:103646937-103646959 CAGTAAAAGCAGTACTAAGAAGG + Intergenic
1195592419 X:106645402-106645424 CAGCAAAAGCAGTAGTAAGAGGG - Intronic
1195662643 X:107395998-107396020 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
1195848872 X:109261083-109261105 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1196089151 X:111720703-111720725 CTAGGAAAGCAGAAGAAAAATGG + Intronic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1196233203 X:113249664-113249686 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
1196333627 X:114502930-114502952 CAGCAAAAGCAGAGCTAAGAGGG + Intergenic
1196509899 X:116497035-116497057 CAGTAAAAGCAGTACTAAGAGGG - Intergenic
1196707120 X:118726557-118726579 AGGGAAAAGGGGAAGTAAGAGGG + Intergenic
1196848790 X:119917982-119918004 GTGGGAAAGCACAAGTAACAAGG - Intronic
1196967495 X:121073837-121073859 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1197068426 X:122263624-122263646 CTGAAAAAGCAGTACTCAGAGGG - Intergenic
1197126462 X:122952284-122952306 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1197360833 X:125501473-125501495 CAGCAAAAGCAGTAGCAAGAGGG - Intergenic
1197391665 X:125874649-125874671 CAGCCAAAGCAGCAGTAAGAAGG - Intergenic
1197440288 X:126479659-126479681 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1197508869 X:127345905-127345927 CAGCAAAAGCAGCACTAAGAGGG - Intergenic
1197512852 X:127392489-127392511 CTGGATCAGCTGAAGTTAGAAGG + Intergenic
1197514787 X:127412714-127412736 CAGGAAGAGCAGCATTAAGAGGG + Intergenic
1197520122 X:127486897-127486919 CAGCAAAAGCAGTAGTGAGAGGG - Intergenic
1197677939 X:129350692-129350714 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
1197815466 X:130493757-130493779 TTGGAAAAGAAGCAGTAAGATGG + Intergenic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1198190777 X:134302828-134302850 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1198665241 X:139014099-139014121 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1198781482 X:140241402-140241424 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1198855841 X:141015174-141015196 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1198872433 X:141189917-141189939 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
1198876289 X:141230965-141230987 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
1198906852 X:141572193-141572215 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
1198917146 X:141685872-141685894 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1198938631 X:141928185-141928207 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1199105583 X:143862870-143862892 CAGGAAAAGCAGAGGTAGAAGGG - Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199227997 X:145401402-145401424 CAGCAAAAGCAGTATTAAGAAGG + Intergenic
1199327586 X:146517646-146517668 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
1199485423 X:148341995-148342017 CAGGAAAACCAGTACTAAGAGGG + Intergenic
1199702523 X:150393150-150393172 CTGGAAAAGGAAAACTATGAAGG - Intronic
1199892631 X:152102053-152102075 CTGGAAAGGCAGAATAAAGCTGG + Intergenic
1200107334 X:153722349-153722371 CTGGAAAAGCAAATGAAAGAGGG - Intronic
1200204758 X:154307883-154307905 CTGGAAATGCAGAACCAAAAGGG + Intronic
1200274017 X:154714896-154714918 TTGGAAAAGCAGCATTAAGTAGG - Intronic
1200482562 Y:3724495-3724517 CAGCAAAAGCAGAACTAAGAGGG + Intergenic
1200668874 Y:6062298-6062320 CAGGAAAAGCAGTACTAGGAGGG - Intergenic
1200975988 Y:9212658-9212680 ATGGAAAAGCAGCAGTATGGTGG - Intergenic
1201329330 Y:12800887-12800909 CTTGAAAAGGAGAAGAAATAAGG - Intronic
1201853967 Y:18520484-18520506 TTGAAAAAGCAGATTTAAGAAGG - Intergenic
1201879354 Y:18799900-18799922 TTGAAAAAGCAGATTTAAGAAGG + Intronic