ID: 1115740382

View in Genome Browser
Species Human (GRCh38)
Location 14:36381550-36381572
Sequence TTGGAGACTCAGAAAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115740376_1115740382 5 Left 1115740376 14:36381522-36381544 CCAAAGGTATGGAGTGATATAAT No data
Right 1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115740382 Original CRISPR TTGGAGACTCAGAAAGAGGG AGG Intergenic
No off target data available for this crispr