ID: 1115741197

View in Genome Browser
Species Human (GRCh38)
Location 14:36390734-36390756
Sequence GGCCTTCTTCCCTGGAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115741197_1115741205 15 Left 1115741197 14:36390734-36390756 CCTGGTCTCCAGGGAAGAAGGCC No data
Right 1115741205 14:36390772-36390794 TGAGCTCACCATGCCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115741197 Original CRISPR GGCCTTCTTCCCTGGAGACC AGG (reversed) Intergenic
No off target data available for this crispr