ID: 1115746546

View in Genome Browser
Species Human (GRCh38)
Location 14:36443776-36443798
Sequence CACGCCCGACCTCCCACGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115746538_1115746546 2 Left 1115746538 14:36443751-36443773 CCCCAGGCATTCATTCAAGTCCC No data
Right 1115746546 14:36443776-36443798 CACGCCCGACCTCCCACGCCAGG No data
1115746535_1115746546 12 Left 1115746535 14:36443741-36443763 CCAGTCCAACCCCCAGGCATTCA No data
Right 1115746546 14:36443776-36443798 CACGCCCGACCTCCCACGCCAGG No data
1115746537_1115746546 3 Left 1115746537 14:36443750-36443772 CCCCCAGGCATTCATTCAAGTCC No data
Right 1115746546 14:36443776-36443798 CACGCCCGACCTCCCACGCCAGG No data
1115746534_1115746546 13 Left 1115746534 14:36443740-36443762 CCCAGTCCAACCCCCAGGCATTC No data
Right 1115746546 14:36443776-36443798 CACGCCCGACCTCCCACGCCAGG No data
1115746536_1115746546 7 Left 1115746536 14:36443746-36443768 CCAACCCCCAGGCATTCATTCAA No data
Right 1115746546 14:36443776-36443798 CACGCCCGACCTCCCACGCCAGG No data
1115746540_1115746546 0 Left 1115746540 14:36443753-36443775 CCAGGCATTCATTCAAGTCCCCC No data
Right 1115746546 14:36443776-36443798 CACGCCCGACCTCCCACGCCAGG No data
1115746539_1115746546 1 Left 1115746539 14:36443752-36443774 CCCAGGCATTCATTCAAGTCCCC No data
Right 1115746546 14:36443776-36443798 CACGCCCGACCTCCCACGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115746546 Original CRISPR CACGCCCGACCTCCCACGCC AGG Intergenic