ID: 1115753122

View in Genome Browser
Species Human (GRCh38)
Location 14:36509552-36509574
Sequence ATATAGCTGGGTCACAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115753122 Original CRISPR ATATAGCTGGGTCACAGTGA TGG (reversed) Intronic
904755321 1:32765680-32765702 ATAGTGCTGGGTTACAGTGAAGG + Intronic
907570988 1:55483636-55483658 ATATACCTTGATCACACTGAAGG + Intergenic
909022353 1:70446244-70446266 ATCTAGTCTGGTCACAGTGATGG + Intergenic
910054200 1:83011934-83011956 ATTTAGTTGGGTCACCTTGAGGG - Intergenic
910066880 1:83164312-83164334 ACAGAGCTGATTCACAGTGACGG - Intergenic
911956859 1:104247101-104247123 AAATCACTGGGTCTCAGTGAGGG - Intergenic
913196540 1:116460963-116460985 AAATAACTGGGTGTCAGTGATGG + Intergenic
913221255 1:116662471-116662493 ATATAGTTGGGTCACAGTAAGGG + Intronic
916520035 1:165555380-165555402 ATATGGCTGGAGCAGAGTGAAGG + Intronic
916748085 1:167699725-167699747 GCATGGCTGGATCACAGTGAGGG - Intronic
916779601 1:168010389-168010411 ATCTAGAGGGGTCACAGTGTTGG + Intronic
916939642 1:169665244-169665266 ACATACCTGGGGCTCAGTGAGGG - Intronic
917526232 1:175790872-175790894 ATGTAGCTGGGAGTCAGTGAGGG - Intergenic
919257034 1:195138942-195138964 ATGTACCCGGGGCACAGTGAGGG - Intergenic
919714201 1:200758460-200758482 ATATAGCTGCCTCAGCGTGATGG - Intronic
921741535 1:218691059-218691081 AAATAGCTGGGGGACAGTGAAGG + Intergenic
921862592 1:220055117-220055139 AGATAGATGGGTTACAGTGTAGG + Intergenic
922077663 1:222263891-222263913 GTATGGCTGGGGCAGAGTGAGGG - Intergenic
922247290 1:223813052-223813074 AGACTGCTGGGTCACAGGGATGG + Intronic
923272922 1:232373647-232373669 ATATAGCTTGCCCACAGGGAGGG - Intergenic
923357645 1:233176397-233176419 TTATGGCTGGGTCACAGAGAAGG - Intronic
924802520 1:247337774-247337796 ATGTCGCTGGGTCACAGTCGGGG + Intergenic
1063414927 10:5865405-5865427 ACATACCTGGGGCTCAGTGAGGG - Intronic
1063814109 10:9752830-9752852 GAATTACTGGGTCACAGTGAAGG - Intergenic
1063969105 10:11368892-11368914 ATAAACCTGGATGACAGTGAAGG + Intergenic
1065090415 10:22227545-22227567 AGATAGGTGGGTCCCAGTGTGGG - Intergenic
1068404834 10:56574989-56575011 ATATACTTGGGGCTCAGTGAGGG + Intergenic
1068546018 10:58346429-58346451 ATATAGCAGGGACCCATTGAAGG + Intronic
1069137222 10:64781584-64781606 ATGTACCTGGGGCTCAGTGAGGG + Intergenic
1071137442 10:82468449-82468471 ACAGATCTGGGTCACATTGAAGG - Intronic
1076293355 10:129364993-129365015 TTATTGCTGGGTCAGTGTGAAGG - Intergenic
1076509637 10:131003566-131003588 AAATAGCTGAGTCCCTGTGAAGG + Intergenic
1080787159 11:35485919-35485941 ATATGGCTGGGACACAGCGCCGG - Intronic
1081421549 11:42878194-42878216 ACATACCTGGGGCTCAGTGAGGG - Intergenic
1083070440 11:59973391-59973413 ATATAGATGAGTCAGTGTGATGG - Intergenic
1088492665 11:110402607-110402629 ACATAGCCGGGGCTCAGTGAGGG - Intergenic
1090873592 11:130769397-130769419 ACATAGCAGGGTCAGGGTGAGGG + Intergenic
1092684795 12:11030754-11030776 ACATAGCAGGGTCAGAGTGAAGG + Exonic
1092687103 12:11061713-11061735 AGATATCAGGGTCAGAGTGAAGG + Exonic
1092689478 12:11091648-11091670 AGATAGTAGGGTCAGAGTGAAGG + Exonic
1092692840 12:11133663-11133685 AGATATCAGGGTCAGAGTGAGGG + Exonic
1092987694 12:13862499-13862521 ATGTAGCTTGGCCACACTGAAGG - Intronic
1093345371 12:18034504-18034526 ACATACCTGGGGCTCAGTGAGGG - Intergenic
1093984975 12:25520395-25520417 ATAAAACTGGTTCACAGGGATGG - Intronic
1096979024 12:55717921-55717943 AGACAGCTGGGTCACTGTCAAGG - Intronic
1099282290 12:80666030-80666052 GTATTGCTGGGTCATAATGATGG - Intronic
1100902795 12:99261962-99261984 ATATAGCTGGATGTCAGTTAAGG - Intronic
1102807983 12:115799022-115799044 AAAGAGCTGGGTCACCTTGATGG + Intergenic
1104194447 12:126519535-126519557 ATATAGCTGTATCACCATGAGGG - Intergenic
1111340675 13:86881864-86881886 AGATATCTGGGTGACAGGGAGGG - Intergenic
1113203795 13:107894091-107894113 ACATACCTGGGGCTCAGTGAGGG + Intergenic
1113252062 13:108464409-108464431 ATGGAGCAAGGTCACAGTGAAGG + Intergenic
1115516375 14:34189323-34189345 AAATATCTGGGTAACATTGAGGG - Intronic
1115753122 14:36509552-36509574 ATATAGCTGGGTCACAGTGATGG - Intronic
1115849027 14:37573221-37573243 ATATATTTGAGTCACAGTTATGG - Intergenic
1115893170 14:38055629-38055651 ATATCTCTGGGTGACTGTGAAGG + Intergenic
1120897663 14:89548412-89548434 ATATAGCAGGGTAACAGAGACGG + Intronic
1124647991 15:31453465-31453487 AAACAGTTGAGTCACAGTGAGGG - Intergenic
1125882683 15:43207967-43207989 AGGGAGTTGGGTCACAGTGAAGG - Intronic
1127819127 15:62639930-62639952 AGATAGCTGGCTCCCAGTGAAGG + Intronic
1128985506 15:72217765-72217787 ATCTGGCTGGGTTTCAGTGAGGG - Intronic
1132507456 16:318619-318641 ATATAGCTGGGATCCAGTGGCGG + Intronic
1137891377 16:52166285-52166307 ATATACCAGGGTTGCAGTGAAGG + Intergenic
1139202163 16:64988932-64988954 ATATAGGAGGGTCACACTGCAGG - Intronic
1139367036 16:66439815-66439837 ATATGTCTGGGTCAAAGTCATGG - Intronic
1140127304 16:72128867-72128889 ATAGAGCTGGGTGAGAGGGAGGG - Intronic
1140624577 16:76776524-76776546 AGAGACATGGGTCACAGTGAAGG - Intergenic
1141656913 16:85421442-85421464 AGAAAGCTGGGGCACAGAGAGGG + Intergenic
1142596972 17:1034626-1034648 GTAAAGCTGGGACCCAGTGAGGG - Intronic
1144454571 17:15408324-15408346 CTATGGCTGGGTGGCAGTGACGG + Intergenic
1144794317 17:17880866-17880888 CTTAAGCTGGGTCACAGTGCAGG - Intronic
1149729284 17:58928617-58928639 AAATTGCTGGGTCACAGGGAAGG - Intronic
1159603652 18:70452598-70452620 ATTTGGATGGGTCACAGAGAGGG - Intergenic
1160729630 19:635246-635268 ATGTAGCTGGGGCTCAGTTAGGG + Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161621429 19:5299286-5299308 ATGTAGCTGGAGCAGAGTGAGGG - Intronic
1162927205 19:13936593-13936615 ATAAGACTGGGTCAGAGTGATGG - Intronic
1164299646 19:23950442-23950464 ATATACCTGGGAGAGAGTGAAGG - Intergenic
1167463786 19:49639836-49639858 TTATAGGAGGGTCTCAGTGATGG + Intronic
1168502745 19:56907176-56907198 AGAGAGCTGGGACACAGCGATGG - Intergenic
926990871 2:18678080-18678102 TTCTATCTGGTTCACAGTGAAGG + Intergenic
930053583 2:47235500-47235522 AGATACCTGGCTCACAGTAAAGG - Intergenic
932203515 2:69855582-69855604 ATATAGCTATGTCACAATTAAGG - Intronic
936113061 2:109680939-109680961 GAATTGCTGGGTCACAGTGTGGG - Intergenic
936641217 2:114314615-114314637 ATATAGGTGAATCACAGTGGAGG + Intergenic
941243531 2:163069970-163069992 ATGTACCTGGGGCTCAGTGAGGG - Intergenic
943102957 2:183509750-183509772 ACATAGCAGGGGCTCAGTGAGGG + Intergenic
1170290174 20:14760574-14760596 ATGGAGCTGGGGCAGAGTGATGG - Intronic
1170523109 20:17209001-17209023 AAATGGTTGGGTCACAGTAAGGG - Intergenic
1172340765 20:34155642-34155664 ACATACCTGGGGCTCAGTGAGGG - Intergenic
1172935079 20:38614451-38614473 ATAGAGATGGGTCACAGAGAAGG - Intronic
1175106668 20:56620068-56620090 ACAGATCTGAGTCACAGTGAGGG + Intergenic
1175279163 20:57791549-57791571 CTATAGCTTGATCACAGTGGGGG - Intergenic
1181066345 22:20307813-20307835 ATGGAGCTGGCTCACCGTGAGGG + Intergenic
1182653332 22:31869863-31869885 ATGGAGCTGGCTCACAGGGAGGG + Intronic
1183011120 22:34947433-34947455 GTGTAGCTGGGCCACAGTGAGGG + Intergenic
1184332591 22:43835532-43835554 ATAAAGCTGAGTCCCAGAGAAGG + Intronic
949749282 3:7332326-7332348 ATATACCTGGTTAATAGTGAGGG + Intronic
950734050 3:14990489-14990511 GCAGAGCTGGGTCACAGAGAGGG + Intronic
951740152 3:25912516-25912538 ATATAAATGAGTGACAGTGATGG - Intergenic
952458769 3:33501963-33501985 ATATAGAGGGCTAACAGTGAGGG - Intronic
952940837 3:38443238-38443260 ATGTACCTGGGGCTCAGTGAGGG + Intergenic
955665153 3:61342384-61342406 ATAAACCTGGCTTACAGTGAAGG - Intergenic
956699559 3:71947205-71947227 ATAGAGCTGAGTAGCAGTGATGG - Intergenic
960063799 3:113349734-113349756 ACATACCTGGGGCTCAGTGAGGG - Intronic
967054277 3:185815058-185815080 ATATATCTGGGTCAAAGGCATGG + Intronic
967153517 3:186671589-186671611 AGATAGCAGTGTCACAGTAAAGG - Intronic
971016308 4:22492863-22492885 ATATATGTGGGTGACAGTGTTGG - Intronic
971578582 4:28306232-28306254 ACATACCTGGGGCTCAGTGAGGG - Intergenic
972772467 4:42210287-42210309 CTGAATCTGGGTCACAGTGAAGG + Intergenic
974786711 4:66626993-66627015 AGATAGATGGGTCACCTTGAAGG - Intergenic
974838753 4:67279082-67279104 ATGTACCCGGGGCACAGTGAGGG + Intergenic
975048103 4:69828083-69828105 ATGTACCTGGGACTCAGTGAGGG - Intronic
975245584 4:72117092-72117114 ATAGAACTGGGTCAGGGTGAAGG - Intronic
976174202 4:82335818-82335840 ACATACCTGGGGCTCAGTGAGGG + Intergenic
976969432 4:91086920-91086942 ATAAAGTTGGTTCACATTGATGG + Intronic
978577668 4:110202517-110202539 ATATAACTGGGTCAGGGTGAAGG + Intergenic
978747275 4:112208666-112208688 ACATACCTGGGGCTCAGTGAGGG - Intergenic
981812508 4:148791619-148791641 ATATAGCTGGTACCCAGAGAAGG - Intergenic
982877399 4:160665574-160665596 ATGTACCTGGGGCTCAGTGAGGG - Intergenic
983237316 4:165194160-165194182 ATGTGGCTGGAGCACAGTGAAGG - Intronic
987181403 5:15372332-15372354 ATATAAGTAGGTGACAGTGATGG + Intergenic
987929990 5:24390382-24390404 ATGTACCTGGGGCTCAGTGAGGG - Intergenic
989951724 5:50307366-50307388 ATATAGTTTGCTCAGAGTGATGG + Intergenic
990788772 5:59453272-59453294 ATATTGCTGTGTCTCAGGGATGG - Intronic
994231632 5:97315051-97315073 ATGTACCTGGGGCTCAGTGAGGG + Intergenic
995583319 5:113622580-113622602 ACATACCTGGGGCTCAGTGAGGG + Intergenic
996099128 5:119429632-119429654 ATGTACCTGGGGCTCAGTGAGGG + Intergenic
996311021 5:122105339-122105361 ATAAAGCAGGGACACTGTGACGG - Intergenic
996581989 5:125041331-125041353 GAATAATTGGGTCACAGTGAAGG + Intergenic
996974227 5:129411057-129411079 CTATAGCAGAGTCAGAGTGATGG + Intergenic
997072495 5:130636810-130636832 ACATACCTGGGGCTCAGTGAGGG - Intergenic
997410302 5:133685843-133685865 ACACGGCTGGGACACAGTGAGGG - Intergenic
997918606 5:137955171-137955193 ATATAGCTATTTGACAGTGAGGG - Intronic
998817860 5:146031885-146031907 ATATACCTGGGGCACATGGAAGG - Intronic
999938552 5:156515802-156515824 AAACGGCTGGGGCACAGTGATGG - Intronic
1000540417 5:162532007-162532029 ATATTTATGGGGCACAGTGAAGG + Intergenic
1004620594 6:17327130-17327152 ATAGAACTGGGTCAGGGTGAAGG + Intergenic
1004988335 6:21107896-21107918 ATATAGCAGTGACACAGTAAAGG + Intronic
1007231827 6:40353639-40353661 ATATAGCTGGGTCACACATGGGG + Intergenic
1011213047 6:84974789-84974811 GTATGGTTGGGTAACAGTGAGGG + Intergenic
1013907756 6:115237923-115237945 ACATACCTGGGGCTCAGTGAGGG + Intergenic
1015622548 6:135146762-135146784 ATAGAGCTGGGTCAAAGTTGGGG - Intergenic
1016055495 6:139573920-139573942 AAATAGCAGGGACCCAGTGAAGG - Intergenic
1021356492 7:19657812-19657834 ATGTACCTGGGGCTCAGTGAGGG + Intergenic
1021654798 7:22864430-22864452 AAGAAGCTGAGTCACAGTGAGGG + Intergenic
1021756634 7:23858875-23858897 ACATACCTGGGGCTCAGTGAGGG + Intergenic
1023088633 7:36597302-36597324 TAATAGCTGAGTCACAGTAATGG - Intronic
1024581365 7:50803640-50803662 ATATCTCTGGGACACAGGGATGG - Intergenic
1027277228 7:76570452-76570474 ACAGAGCTGATTCACAGTGATGG + Intergenic
1028495136 7:91453104-91453126 ACATACCTGGGGCTCAGTGAGGG + Intergenic
1030499057 7:110336203-110336225 AGATAACTGGGGCACAGTAAGGG - Intergenic
1034397182 7:150836036-150836058 ATAGAACAGGGACACAGTGAAGG + Intronic
1034493121 7:151404939-151404961 CTAAAGCTGGGACACAGGGAAGG - Intronic
1035659231 8:1334310-1334332 GGAACGCTGGGTCACAGTGATGG - Intergenic
1038638878 8:29308207-29308229 ACATACCTGGGGCTCAGTGAGGG - Intergenic
1039693089 8:39882267-39882289 ATGTACCTGGGGCTCAGTGAGGG + Intergenic
1040999845 8:53439633-53439655 ATGTACCTGGGGCTCAGTGAGGG + Intergenic
1041236443 8:55807482-55807504 ATATAGCTGGGTCATAAAGCAGG + Intronic
1045265640 8:100616640-100616662 ATCTAGCTGGGAAACAATGAGGG + Intronic
1046311583 8:112444323-112444345 AAATTGCTGGGTCACAGGGAAGG - Intronic
1047850021 8:128846798-128846820 ATGTAGATGGGTCAGAGGGAAGG + Intergenic
1049342329 8:142119816-142119838 GTCTAGCGGGGTCACAGAGATGG - Intergenic
1052606956 9:30716058-30716080 GAATTGCTGGGTCACAGTGTAGG + Intergenic
1056968268 9:91181796-91181818 GTAAGTCTGGGTCACAGTGAAGG + Intergenic
1059609782 9:115879718-115879740 AGACACCTGGGTCACAGGGAAGG + Intergenic
1060615519 9:125009738-125009760 AATTAGCTGGGCCACTGTGATGG + Intronic
1061606996 9:131718243-131718265 GTGTGGCTGGGACACAGTGACGG + Intronic
1188097609 X:26043339-26043361 ACATACCTGGGGCTCAGTGAGGG - Intergenic
1188565070 X:31517611-31517633 ATGTAGCAGGGTCAGAGTGAAGG + Intronic
1192562458 X:72136197-72136219 AAATGGCTGGGTCAGAGTCAAGG - Intronic
1192869926 X:75175535-75175557 ACATACCTGGGGCTCAGTGAGGG + Intergenic
1193849788 X:86522877-86522899 ATATCTCTGGATCACACTGATGG + Intronic
1200250102 X:154548214-154548236 CTATAGCTGGAGCAGAGTGAGGG + Intronic
1200694894 Y:6350210-6350232 ATGTACCTGGGGCTCAGTGAGGG + Intergenic
1200959387 Y:8983092-8983114 ATGTACCTGGGGCTCAGTGAGGG - Intergenic
1201040383 Y:9824500-9824522 ATGTACCTGGGGCTCAGTGAGGG - Intergenic
1201271862 Y:12263486-12263508 ATGTACCTGGGGCTCAGTGAGGG + Intergenic
1201403837 Y:13631028-13631050 ATATACCTGGGGCTCAGTGAGGG - Intergenic
1201496315 Y:14594168-14594190 ACATACCTGGGGCTCAGTGAGGG + Intronic
1201515891 Y:14818501-14818523 ATGTACCTGGGGCTCAGTGAGGG + Intronic
1201908140 Y:19105994-19106016 ATATACCTGGGGCTCAGTGAGGG + Intergenic
1202146605 Y:21805532-21805554 ATGTAGCTGGGGCTCAGTGAGGG + Intergenic