ID: 1115754702

View in Genome Browser
Species Human (GRCh38)
Location 14:36519509-36519531
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115754702_1115754713 25 Left 1115754702 14:36519509-36519531 CCGAGTCCTCCTTAATTGGCTTG 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1115754713 14:36519557-36519579 GTTTGTTTTAGCCCGGCGCCAGG 0: 1
1: 0
2: 1
3: 0
4: 18
1115754702_1115754707 -10 Left 1115754702 14:36519509-36519531 CCGAGTCCTCCTTAATTGGCTTG 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1115754707 14:36519522-36519544 AATTGGCTTGAGTGGAGGCTCGG 0: 1
1: 0
2: 2
3: 25
4: 205
1115754702_1115754711 18 Left 1115754702 14:36519509-36519531 CCGAGTCCTCCTTAATTGGCTTG 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1115754711 14:36519550-36519572 GCCTCGCGTTTGTTTTAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 34
1115754702_1115754708 -9 Left 1115754702 14:36519509-36519531 CCGAGTCCTCCTTAATTGGCTTG 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1115754708 14:36519523-36519545 ATTGGCTTGAGTGGAGGCTCGGG 0: 1
1: 0
2: 0
3: 13
4: 156
1115754702_1115754710 -7 Left 1115754702 14:36519509-36519531 CCGAGTCCTCCTTAATTGGCTTG 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1115754710 14:36519525-36519547 TGGCTTGAGTGGAGGCTCGGGGG 0: 1
1: 0
2: 0
3: 18
4: 146
1115754702_1115754709 -8 Left 1115754702 14:36519509-36519531 CCGAGTCCTCCTTAATTGGCTTG 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1115754709 14:36519524-36519546 TTGGCTTGAGTGGAGGCTCGGGG 0: 1
1: 0
2: 1
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115754702 Original CRISPR CAAGCCAATTAAGGAGGACT CGG (reversed) Intronic