ID: 1115754704

View in Genome Browser
Species Human (GRCh38)
Location 14:36519515-36519537
Sequence TCCACTCAAGCCAATTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115754704_1115754713 19 Left 1115754704 14:36519515-36519537 CCTCCTTAATTGGCTTGAGTGGA 0: 1
1: 0
2: 1
3: 4
4: 66
Right 1115754713 14:36519557-36519579 GTTTGTTTTAGCCCGGCGCCAGG 0: 1
1: 0
2: 1
3: 0
4: 18
1115754704_1115754714 26 Left 1115754704 14:36519515-36519537 CCTCCTTAATTGGCTTGAGTGGA 0: 1
1: 0
2: 1
3: 4
4: 66
Right 1115754714 14:36519564-36519586 TTAGCCCGGCGCCAGGTTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 28
1115754704_1115754711 12 Left 1115754704 14:36519515-36519537 CCTCCTTAATTGGCTTGAGTGGA 0: 1
1: 0
2: 1
3: 4
4: 66
Right 1115754711 14:36519550-36519572 GCCTCGCGTTTGTTTTAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115754704 Original CRISPR TCCACTCAAGCCAATTAAGG AGG (reversed) Intronic