ID: 1115754706

View in Genome Browser
Species Human (GRCh38)
Location 14:36519518-36519540
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115754706_1115754711 9 Left 1115754706 14:36519518-36519540 CCTTAATTGGCTTGAGTGGAGGC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1115754711 14:36519550-36519572 GCCTCGCGTTTGTTTTAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 34
1115754706_1115754714 23 Left 1115754706 14:36519518-36519540 CCTTAATTGGCTTGAGTGGAGGC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1115754714 14:36519564-36519586 TTAGCCCGGCGCCAGGTTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 28
1115754706_1115754713 16 Left 1115754706 14:36519518-36519540 CCTTAATTGGCTTGAGTGGAGGC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1115754713 14:36519557-36519579 GTTTGTTTTAGCCCGGCGCCAGG 0: 1
1: 0
2: 1
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115754706 Original CRISPR GCCTCCACTCAAGCCAATTA AGG (reversed) Intronic