ID: 1115754706 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:36519518-36519540 |
| Sequence | GCCTCCACTCAAGCCAATTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 89 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 85} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1115754706_1115754714 | 23 | Left | 1115754706 | 14:36519518-36519540 | CCTTAATTGGCTTGAGTGGAGGC | 0: 1 1: 0 2: 0 3: 3 4: 85 |
||
| Right | 1115754714 | 14:36519564-36519586 | TTAGCCCGGCGCCAGGTTTTAGG | 0: 1 1: 0 2: 0 3: 3 4: 28 |
||||
| 1115754706_1115754713 | 16 | Left | 1115754706 | 14:36519518-36519540 | CCTTAATTGGCTTGAGTGGAGGC | 0: 1 1: 0 2: 0 3: 3 4: 85 |
||
| Right | 1115754713 | 14:36519557-36519579 | GTTTGTTTTAGCCCGGCGCCAGG | 0: 1 1: 0 2: 1 3: 0 4: 18 |
||||
| 1115754706_1115754711 | 9 | Left | 1115754706 | 14:36519518-36519540 | CCTTAATTGGCTTGAGTGGAGGC | 0: 1 1: 0 2: 0 3: 3 4: 85 |
||
| Right | 1115754711 | 14:36519550-36519572 | GCCTCGCGTTTGTTTTAGCCCGG | 0: 1 1: 0 2: 0 3: 0 4: 34 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1115754706 | Original CRISPR | GCCTCCACTCAAGCCAATTA AGG (reversed) | Intronic | ||