ID: 1115754711 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:36519550-36519572 |
Sequence | GCCTCGCGTTTGTTTTAGCC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 35 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 0, 4: 34} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1115754706_1115754711 | 9 | Left | 1115754706 | 14:36519518-36519540 | CCTTAATTGGCTTGAGTGGAGGC | 0: 1 1: 0 2: 0 3: 3 4: 85 |
||
Right | 1115754711 | 14:36519550-36519572 | GCCTCGCGTTTGTTTTAGCCCGG | 0: 1 1: 0 2: 0 3: 0 4: 34 |
||||
1115754702_1115754711 | 18 | Left | 1115754702 | 14:36519509-36519531 | CCGAGTCCTCCTTAATTGGCTTG | 0: 1 1: 0 2: 1 3: 10 4: 131 |
||
Right | 1115754711 | 14:36519550-36519572 | GCCTCGCGTTTGTTTTAGCCCGG | 0: 1 1: 0 2: 0 3: 0 4: 34 |
||||
1115754704_1115754711 | 12 | Left | 1115754704 | 14:36519515-36519537 | CCTCCTTAATTGGCTTGAGTGGA | 0: 1 1: 0 2: 1 3: 4 4: 66 |
||
Right | 1115754711 | 14:36519550-36519572 | GCCTCGCGTTTGTTTTAGCCCGG | 0: 1 1: 0 2: 0 3: 0 4: 34 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1115754711 | Original CRISPR | GCCTCGCGTTTGTTTTAGCC CGG | Intronic | ||