ID: 1115754711

View in Genome Browser
Species Human (GRCh38)
Location 14:36519550-36519572
Sequence GCCTCGCGTTTGTTTTAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115754702_1115754711 18 Left 1115754702 14:36519509-36519531 CCGAGTCCTCCTTAATTGGCTTG 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1115754711 14:36519550-36519572 GCCTCGCGTTTGTTTTAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 34
1115754706_1115754711 9 Left 1115754706 14:36519518-36519540 CCTTAATTGGCTTGAGTGGAGGC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1115754711 14:36519550-36519572 GCCTCGCGTTTGTTTTAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 34
1115754704_1115754711 12 Left 1115754704 14:36519515-36519537 CCTCCTTAATTGGCTTGAGTGGA 0: 1
1: 0
2: 1
3: 4
4: 66
Right 1115754711 14:36519550-36519572 GCCTCGCGTTTGTTTTAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115754711 Original CRISPR GCCTCGCGTTTGTTTTAGCC CGG Intronic
901704807 1:11065364-11065386 GGCTGGAGTTTGTTTTAGCTAGG - Intergenic
922958999 1:229628985-229629007 GCCTCCCCTTTGTTTCACCCTGG - Intronic
1063261751 10:4397070-4397092 TCCTTGTGTTTGTATTAGCCGGG + Intergenic
1070359139 10:75670676-75670698 CCTTCCCGTTTGTCTTAGCCTGG + Intronic
1094032550 12:26029272-26029294 GCCTCACATATGTTTTAGCTGGG + Intronic
1114083940 14:19224221-19224243 TCCTCGCATTTTTTTTAGCTAGG + Intergenic
1115754711 14:36519550-36519572 GCCTCGCGTTTGTTTTAGCCCGG + Intronic
1120922839 14:89770801-89770823 TCCTCGTGTTTGGTTTAGGCTGG - Intergenic
1123395444 15:19929869-19929891 GTCTGGCTTTTGCTTTAGCCTGG + Intergenic
1124193655 15:27601413-27601435 GCCTTGCGGTTGTTTCAACCTGG - Intergenic
1129265314 15:74390162-74390184 GCCTGGCGTTTGGATGAGCCAGG - Intergenic
1133754014 16:8748445-8748467 GCCTAGCGTATGGTCTAGCCTGG + Intronic
1139667676 16:68469234-68469256 CCCTCGCTTTTGTCATAGCCTGG + Intergenic
1149614321 17:57986196-57986218 GCTTGGCATTTGTTTTACCCAGG + Intronic
1157236158 18:45967170-45967192 TCCTCACCTTTGTTTTAGTCCGG + Exonic
1159918611 18:74207402-74207424 GCCCTGAGTTTGTTTTAGGCAGG - Intergenic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
934556426 2:95289249-95289271 TCCTCCCCTTTGATTTAGCCTGG + Exonic
935385995 2:102500786-102500808 GCCTCACGTTTGTTTGAGGGAGG - Intronic
1175036365 20:56004699-56004721 GCCTCGCGTTCTTCTCAGCCTGG - Exonic
1180294034 22:10869042-10869064 TCCTCGCATTTTTTTTAGCTAGG - Intergenic
1180321530 22:11325884-11325906 GCCTCGGTTTTGTAGTAGCCTGG - Intergenic
958762494 3:98326151-98326173 GTCTCTCTTTTGTTTGAGCCAGG + Intergenic
963792005 3:149592987-149593009 GCCTGGAGTTTTTTTTAGCAGGG - Intronic
997366419 5:133328115-133328137 GCCTCGTGTGTGTTTAACCCTGG - Intronic
998962972 5:147508881-147508903 GCCTCGCTTGTGTCTTAGCACGG - Intronic
1016071326 6:139742470-139742492 GTCTACCGTTTGTTTTATCCAGG + Intergenic
1020054635 7:5108936-5108958 GCCTAGCTTTTGTCTTCGCCTGG - Intergenic
1035979025 8:4348063-4348085 GCCACTGGTTTGTTTTTGCCTGG - Intronic
1040969453 8:53118125-53118147 TCCTTGCATTTGTTTTAGTCTGG + Intergenic
1052556089 9:30019874-30019896 GCCTCAGGTTAGTTTAAGCCAGG - Intergenic
1054327933 9:63725586-63725608 TCCTCGCATTTTTTTTAGCTAGG - Intergenic
1186469063 X:9807153-9807175 GCCTCGAGTATGTCTGAGCCTGG + Intronic
1201763450 Y:17560967-17560989 GCCTCGAGGTTGTTTTCCCCGGG + Intergenic
1201838103 Y:18345023-18345045 GCCTCGAGGTTGTTTTCCCCGGG - Intergenic