ID: 1115754711

View in Genome Browser
Species Human (GRCh38)
Location 14:36519550-36519572
Sequence GCCTCGCGTTTGTTTTAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115754704_1115754711 12 Left 1115754704 14:36519515-36519537 CCTCCTTAATTGGCTTGAGTGGA 0: 1
1: 0
2: 1
3: 4
4: 66
Right 1115754711 14:36519550-36519572 GCCTCGCGTTTGTTTTAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 34
1115754702_1115754711 18 Left 1115754702 14:36519509-36519531 CCGAGTCCTCCTTAATTGGCTTG 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1115754711 14:36519550-36519572 GCCTCGCGTTTGTTTTAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 34
1115754706_1115754711 9 Left 1115754706 14:36519518-36519540 CCTTAATTGGCTTGAGTGGAGGC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1115754711 14:36519550-36519572 GCCTCGCGTTTGTTTTAGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115754711 Original CRISPR GCCTCGCGTTTGTTTTAGCC CGG Intronic