ID: 1115755040

View in Genome Browser
Species Human (GRCh38)
Location 14:36520842-36520864
Sequence ACTTTTGCATGGCTGAGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115755040_1115755042 -8 Left 1115755040 14:36520842-36520864 CCGCAGCTCAGCCATGCAAAAGT 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1115755042 14:36520857-36520879 GCAAAAGTGCTCTTGCTTCCCGG 0: 1
1: 0
2: 0
3: 23
4: 154
1115755040_1115755047 21 Left 1115755040 14:36520842-36520864 CCGCAGCTCAGCCATGCAAAAGT 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1115755047 14:36520886-36520908 CCAAATATCTTTGTTTAAAGTGG 0: 1
1: 2
2: 3
3: 20
4: 293
1115755040_1115755048 24 Left 1115755040 14:36520842-36520864 CCGCAGCTCAGCCATGCAAAAGT 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1115755048 14:36520889-36520911 AATATCTTTGTTTAAAGTGGTGG 0: 1
1: 0
2: 3
3: 26
4: 355
1115755040_1115755043 -7 Left 1115755040 14:36520842-36520864 CCGCAGCTCAGCCATGCAAAAGT 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1115755043 14:36520858-36520880 CAAAAGTGCTCTTGCTTCCCGGG 0: 1
1: 0
2: 2
3: 13
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115755040 Original CRISPR ACTTTTGCATGGCTGAGCTG CGG (reversed) Intronic
900409514 1:2506421-2506443 CCCTCTGCCTGGCTGAGCTGGGG - Intergenic
900508239 1:3040980-3041002 ACATTTGCAGGGCTGAACTAAGG - Intergenic
901201543 1:7470056-7470078 GCTTCTTCATGGCCGAGCTGGGG + Intronic
904366158 1:30012102-30012124 AGTTCAGCATGGCTGAGCAGAGG - Intergenic
905168216 1:36096002-36096024 ACTTCTGACTGGCTGAGCAGTGG - Exonic
905460953 1:38122789-38122811 ATTTTTGCAGGGCTGTCCTGGGG + Intergenic
905715251 1:40143990-40144012 ACTCCTGCAGGGCTGATCTGGGG + Intergenic
906557245 1:46723640-46723662 ACTTTGCTATGGCTGAGGTGGGG + Intergenic
907404572 1:54246001-54246023 AGTTGTGCGTGGCTGAGCTGGGG + Intronic
907983231 1:59505496-59505518 ACTTTGGCAAAACTGAGCTGGGG + Intronic
908368242 1:63449915-63449937 ACTTTTTCAAGCCTGAGTTGGGG + Intronic
909602843 1:77478903-77478925 ACTTTTGCAAGGCTGGGTTCTGG - Intronic
909806023 1:79875279-79875301 ACTTTTGCAACGCTGGGCTCAGG + Intergenic
910553295 1:88500722-88500744 AGTTCTGCATGGCTGAGGGGAGG - Intergenic
912775381 1:112503350-112503372 AATAGTGCATGGCTGAGTTGGGG + Intronic
917535354 1:175870594-175870616 CCTGTGGCTTGGCTGAGCTGTGG + Intergenic
921970929 1:221148301-221148323 GCTAATGCATGGCAGAGCTGAGG + Intergenic
1066049616 10:31621582-31621604 CCTTGTGCAGGGCTGGGCTGGGG - Intergenic
1066436204 10:35398385-35398407 CCTTTTGCATGGCGGAGATTCGG + Intronic
1067060509 10:43075920-43075942 CCTCTTGCCTGGCTGAGCTCAGG - Intergenic
1067503718 10:46831292-46831314 AGTTTGGAATGACTGAGCTGGGG - Intergenic
1067875500 10:50003534-50003556 AGTTTGGAATGACTGAGCTGGGG - Intronic
1069559924 10:69422210-69422232 GCTGTGGCATGGCTGAGGTGAGG + Intergenic
1069666687 10:70166739-70166761 CATTTTGCAAGGCTGAGGTGGGG + Intronic
1069823769 10:71242922-71242944 ACTCTTGAATGGGTGGGCTGAGG - Intronic
1072192357 10:93086471-93086493 ACTTTTGATTGGCTGAGCGCAGG + Intergenic
1072880492 10:99222247-99222269 ACTAGTAAATGGCTGAGCTGTGG - Intronic
1073478583 10:103771250-103771272 ACATATGCATGTCAGAGCTGGGG - Intronic
1075643689 10:124084065-124084087 ACCTTTGCAAGGCAGAGCTAGGG + Intronic
1082921476 11:58499397-58499419 ACTTTTTGTTGGCTGAGCTTAGG + Intergenic
1083322100 11:61854126-61854148 ACTTTCACCTGGCTGGGCTGCGG - Intronic
1085866973 11:80305607-80305629 CCTCTTGGGTGGCTGAGCTGTGG - Intergenic
1085884475 11:80505985-80506007 ACATTGGCTTTGCTGAGCTGTGG - Intergenic
1086482567 11:87258614-87258636 CCATTTGCATGGCTGCACTGTGG + Intronic
1087212422 11:95457522-95457544 ATCTTTTCATGGCTGAGCTGGGG + Intergenic
1088762062 11:112940747-112940769 ACATTTGGAGGGCTGAGCTAGGG - Intergenic
1091564632 12:1639459-1639481 GGTTTCGCAGGGCTGAGCTGGGG + Intronic
1092285883 12:7129124-7129146 ACCTTTGGATGGCTGAGTTTTGG - Intergenic
1093882407 12:24420042-24420064 ACTTTTCCATGCTTGAGGTGTGG + Intergenic
1094122885 12:26992698-26992720 ACTCTTGCAACGCTGAGCAGTGG - Intronic
1094252725 12:28383589-28383611 ACTTCTGCCTGGCTGGGCTGCGG + Intronic
1094390740 12:29947556-29947578 ACTTTTCCATGGCTGTGGTATGG - Intergenic
1096319337 12:50598127-50598149 ACTTTTGCATTACTGAGCAAAGG + Intronic
1097534264 12:60846477-60846499 ACTTTAGGATTGCTTAGCTGTGG - Intergenic
1097678236 12:62625304-62625326 AGTTCTGCATGGCTGAGCAGAGG + Intergenic
1104138406 12:125962503-125962525 AGTTGTGCATGGCTGAGGGGAGG + Intergenic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1106719745 13:32426268-32426290 ACTTTCGCTTTGCTGATCTGTGG - Intronic
1107300596 13:38961878-38961900 ACTTTTCCTTGTCAGAGCTGTGG - Intergenic
1109040846 13:57334213-57334235 ACTGTTGGAAGGATGAGCTGAGG - Intergenic
1109723513 13:66308483-66308505 CATTGTGCATGGCTGACCTGAGG - Intronic
1110838745 13:80116348-80116370 ACTTTGTCATGCCTGCGCTGAGG - Intergenic
1112109652 13:96282170-96282192 ATCTTTGCATGACTGGGCTGAGG - Intronic
1112308748 13:98299191-98299213 ACTTCTGCATGGTAGAACTGTGG - Intronic
1113016766 13:105836662-105836684 ACTAGTGCATGGCTTAGTTGTGG + Intergenic
1114346155 14:21797406-21797428 ACAGGAGCATGGCTGAGCTGTGG - Intergenic
1114552669 14:23542376-23542398 ACATTTGCATGGATTTGCTGAGG + Intronic
1115755040 14:36520842-36520864 ACTTTTGCATGGCTGAGCTGCGG - Intronic
1116141084 14:40995129-40995151 ACTTTATTGTGGCTGAGCTGAGG + Intergenic
1117121087 14:52568702-52568724 ACATTGGCTTTGCTGAGCTGCGG - Intronic
1120019661 14:79514403-79514425 ACTTTTGCAGGACTAAGTTGAGG - Intronic
1121022806 14:90591832-90591854 ACTTTTGCATAAGGGAGCTGTGG + Intronic
1121099893 14:91243226-91243248 ACTGGAGCTTGGCTGAGCTGGGG - Intronic
1121309043 14:92924868-92924890 ATTCATTCATGGCTGAGCTGGGG + Intronic
1121482313 14:94288716-94288738 TATTTTGCCTGCCTGAGCTGTGG - Intronic
1124135194 15:27029043-27029065 AGGTTTCCAAGGCTGAGCTGTGG + Intronic
1126321801 15:47432012-47432034 AATGTTACATGGCTGGGCTGGGG + Intronic
1127691719 15:61403378-61403400 TCTTTTTCATGGCTGAGAGGAGG + Intergenic
1128261992 15:66239066-66239088 GCTTTTAAATGGCAGAGCTGGGG + Intronic
1128340658 15:66820572-66820594 ACTTTTGCATGCCTTGGCTCAGG + Intergenic
1129484936 15:75861792-75861814 ACTATTGTATGGCTTAACTGGGG + Intronic
1130095701 15:80854266-80854288 ACATTTGCAGAGCTGAGCTGTGG - Intronic
1131542999 15:93290096-93290118 GGTTTTGCTCGGCTGAGCTGTGG + Intergenic
1132627912 16:901022-901044 ACGTCTGCATGGCTGTCCTGGGG - Intronic
1135890294 16:26350820-26350842 TCCTTGGCATGTCTGAGCTGTGG - Intergenic
1136222284 16:28836199-28836221 AATTTGGCATGGAAGAGCTGAGG + Intronic
1137302508 16:47165958-47165980 ACTTTTGAATGCCTGAGGGGAGG - Intronic
1139063384 16:63283129-63283151 ACTGTTCCATGGCTGCTCTGGGG + Intergenic
1139450440 16:67024808-67024830 CCTATGGGATGGCTGAGCTGGGG + Intergenic
1142405045 16:89883869-89883891 ACGTTTGCTTGGCTGGGTTGTGG + Intronic
1143643161 17:8211148-8211170 CCTTATGCATGTATGAGCTGGGG + Intergenic
1144879096 17:18421793-18421815 CTTTTTGCATGCCTGTGCTGTGG + Intergenic
1145018168 17:19412192-19412214 GCATTTGCATGGCTGGGATGTGG + Intronic
1145153138 17:20522594-20522616 CTTTTTGCATGCCTGTGCTGTGG - Intergenic
1145797438 17:27664047-27664069 AGGTTTGCATGGCCCAGCTGCGG + Intergenic
1146965999 17:37030285-37030307 ACCTTTGGGAGGCTGAGCTGTGG + Intronic
1150657764 17:67051526-67051548 ACTCTTACATGGCTGAACTGGGG - Intronic
1151280330 17:73069178-73069200 ACTTCTTCATGGATGAGCTTGGG - Intronic
1154140991 18:11824244-11824266 TTTTTTTCATGGCTGAGATGGGG + Intronic
1157193720 18:45602474-45602496 GCTTTTCCATGGATGAGCTCTGG + Intronic
1158447815 18:57536441-57536463 ACTATTGCATGTCAGAGATGAGG + Intergenic
1158549367 18:58422130-58422152 ACTTTTCTATGGCTGATCCGGGG + Intergenic
1158838796 18:61360743-61360765 CCTTTTGCCTGGCTGGGCTTTGG - Intronic
1160372637 18:78387514-78387536 ACTTTTGCATTGCTGTGGTGAGG - Intergenic
1162001617 19:7747751-7747773 ACTCATGGATGGCTGAGCAGTGG + Intergenic
1163810261 19:19426880-19426902 TCAGTGGCATGGCTGAGCTGGGG + Intronic
1166286742 19:41835502-41835524 AGTTTTAGAAGGCTGAGCTGAGG - Intergenic
1166612072 19:44207493-44207515 GCTTTTGGATGGCGGAGCTAGGG + Intergenic
1167037336 19:47002087-47002109 AAACTTGCATGGCTGGGCTGTGG + Exonic
925480696 2:4270163-4270185 ACTTTTGCTGACCTGAGCTGGGG - Intergenic
925779122 2:7364157-7364179 AGTTCTGCATGGCTGGGGTGCGG - Intergenic
925822223 2:7810945-7810967 AGTCTTGCATTTCTGAGCTGTGG + Intergenic
925942015 2:8829938-8829960 TCTTCTGCTTGGCTGGGCTGTGG - Intronic
926422193 2:12710919-12710941 ACTTTACCATGGCTAGGCTGGGG - Intergenic
926832297 2:16976830-16976852 AGTTCTGCAAGGCTTAGCTGTGG + Intergenic
929317611 2:40498897-40498919 ACTATTTCTTGGCTGAGTTGGGG + Intronic
929715525 2:44305671-44305693 ACTTTTGGGAGGCTGAGGTGGGG - Intronic
930022543 2:47010017-47010039 GCCTATGAATGGCTGAGCTGAGG - Intronic
931021410 2:58048118-58048140 AAAGTTGCATGGCTGTGCTGTGG + Intronic
933253235 2:80051873-80051895 ACTTTTGCATCTTTGTGCTGGGG - Intronic
933271647 2:80239297-80239319 AGTTTCGCATAGCTAAGCTGGGG - Intronic
933975796 2:87508365-87508387 TCTTCTACTTGGCTGAGCTGTGG - Intergenic
936054777 2:109254220-109254242 ACCTTTGGATGTCTGACCTGAGG + Intronic
936318028 2:111442448-111442470 TCTTCTACTTGGCTGAGCTGTGG + Intergenic
938389733 2:130895270-130895292 CCTTTTCCATGGCTGAGGGGTGG + Intronic
940251338 2:151679940-151679962 ACTTTAGCCTGGATGAACTGGGG + Exonic
940623940 2:156149282-156149304 ATTTTTGCATGGATGGGGTGGGG - Intergenic
942490030 2:176480783-176480805 ACTTTTTAATGGCTGTGCAGAGG + Intergenic
945163761 2:206920576-206920598 ACCTTAACATGGCTGAGCTAAGG + Intergenic
946622839 2:221577198-221577220 TCTTTTGCATCACTGAGGTGAGG + Intergenic
948411570 2:237766565-237766587 ACGGCTGGATGGCTGAGCTGAGG - Intronic
1169830099 20:9815521-9815543 ACTGTTCCATGTCAGAGCTGGGG - Intronic
1170447900 20:16448547-16448569 GCTTTTGCCTGGCTGAGGAGTGG - Intronic
1172921483 20:38486504-38486526 AATTCTGCAGGTCTGAGCTGGGG - Intronic
1174266807 20:49337997-49338019 ACTTTGGCAAGGCTGAGATGTGG + Intergenic
1174696096 20:52560565-52560587 ACAGTTGCATGGCTGACATGGGG + Intergenic
1175570041 20:60011574-60011596 ACAATGGCAGGGCTGAGCTGTGG - Intronic
1175965109 20:62656499-62656521 CGTTTTCCATGGCTGAGTTGGGG - Exonic
1176116817 20:63435614-63435636 ACGCCTGCATGGCTGAGATGAGG + Intronic
1176201638 20:63863442-63863464 ACATTGGCATGGCAGGGCTGTGG + Intergenic
1179305151 21:40146812-40146834 GCTTTTGCATTGATGAGCTATGG + Intronic
1180944066 22:19679998-19680020 AGTTCTGCAAGGCTGAGCGGTGG - Intergenic
1181684535 22:24519551-24519573 CCATGTGCTTGGCTGAGCTGTGG - Intronic
950110806 3:10417393-10417415 ACTTTCTAATGGGTGAGCTGAGG + Intronic
950545198 3:13634215-13634237 ACTTTTGCACATCTGAGTTGCGG + Intronic
959672274 3:108992260-108992282 ACATTTACATGGCAGAGATGTGG - Intronic
961454357 3:127016855-127016877 GGCTTTGCCTGGCTGAGCTGTGG + Intronic
962534775 3:136317863-136317885 ACTCTTCCATGGCTGTGCTCTGG + Intronic
964028374 3:152105633-152105655 ACTATTCCATGCCTGAGCTGTGG - Intergenic
964557148 3:157952243-157952265 TCTTTTGCATGGCAGAACTGAGG - Intergenic
964624852 3:158748992-158749014 GCTTCTCCATGGCTGGGCTGGGG + Intronic
966985539 3:185176789-185176811 ACTTGTGCATGGGTGGGATGCGG - Intergenic
967283803 3:187849496-187849518 TCACTTGGATGGCTGAGCTGTGG + Intergenic
968310025 3:197675499-197675521 CCTTTGGCTTGGCAGAGCTGGGG + Exonic
970250323 4:14108308-14108330 ATTCTTGAATGTCTGAGCTGGGG + Intergenic
970374130 4:15439479-15439501 ACTAATCCATGGCTGAACTGGGG + Intronic
975151184 4:71022651-71022673 AATAATGAATGGCTGAGCTGGGG + Intronic
975748963 4:77502940-77502962 AGTTTGGTATGGCTGAGATGTGG - Intergenic
976196203 4:82534305-82534327 TCTTTTGCAGGGGTGAGGTGAGG - Intronic
976713766 4:88101312-88101334 CCCTTTTCATGGCAGAGCTGGGG - Exonic
978444335 4:108766262-108766284 ACTTGTGCATGACTGAAATGAGG + Intergenic
979531880 4:121777173-121777195 AATGCTGTATGGCTGAGCTGGGG + Intergenic
980280875 4:130718018-130718040 TTTTTTCCATGGCTGAGCAGTGG + Intergenic
982121571 4:152148310-152148332 ACTTTTCCTGGGCTGGGCTGTGG - Intergenic
984811693 4:183800936-183800958 GCTTTTGTCTGGCTGTGCTGTGG + Intergenic
985044837 4:185929943-185929965 TTTTATCCATGGCTGAGCTGAGG - Intronic
985853292 5:2404740-2404762 ACTTTTCTAGGGTTGAGCTGTGG - Intergenic
986353101 5:6898627-6898649 AACTTTGGAAGGCTGAGCTGGGG + Intergenic
987427242 5:17787205-17787227 ACTTCTTCATTGCTGAACTGTGG - Intergenic
988719233 5:33859417-33859439 ACAGTGGCATTGCTGAGCTGCGG - Intronic
988786009 5:34565873-34565895 ACTTTAGCAGGGCTGATTTGCGG + Intergenic
989350165 5:40477130-40477152 CCTTTTCCAAGGCAGAGCTGAGG - Intergenic
990719842 5:58682079-58682101 ACATTTGTATGGTTGAGGTGAGG + Intronic
999384744 5:151146123-151146145 CCTTCTGCCTGGCTGATCTGTGG - Intronic
999591910 5:153157538-153157560 AGTTTTGTATGGCTGGGATGTGG + Intergenic
1003575251 6:7287242-7287264 ACTGTATCATGGCTGTGCTGGGG - Exonic
1004315720 6:14585635-14585657 ACCCTGGCATGGCTGAGCTTTGG - Intergenic
1004466015 6:15885673-15885695 AGTTTAGCATGGCTGAAATGTGG - Intergenic
1004770567 6:18776513-18776535 ACTGTTGCTTTTCTGAGCTGAGG - Intergenic
1006748333 6:36360803-36360825 CCTTTTGCAGGGCTGAGGTCTGG - Intronic
1007246554 6:40467457-40467479 ATGTGAGCATGGCTGAGCTGTGG - Intronic
1007602751 6:43093368-43093390 CATTTTGAAAGGCTGAGCTGGGG + Intronic
1007913349 6:45537553-45537575 ACTTCTGCAGATCTGAGCTGTGG + Intronic
1008428649 6:51388886-51388908 ACCTTCCCATGACTGAGCTGTGG + Intergenic
1010744160 6:79542090-79542112 ACTGTTGCCTGGCAGAGCAGTGG - Intergenic
1015162385 6:130168070-130168092 ACTTCTGCAGGTCTGAGCAGAGG - Intronic
1022405252 7:30083652-30083674 ACTTTTGCATTGCAGAGTAGTGG - Exonic
1028689058 7:93629760-93629782 ACTTTTACATGGTAGGGCTGTGG + Intronic
1033809061 7:144989262-144989284 ACTTTGGCATGAGTGAGATGGGG - Intergenic
1036092582 8:5683510-5683532 ACCTTTTCATGGCTTCGCTGTGG + Intergenic
1038531326 8:28320220-28320242 ACTGTGGGATGGCAGAGCTGGGG - Intronic
1041113308 8:54507935-54507957 ACTTTCGAGTGTCTGAGCTGTGG + Intergenic
1041116758 8:54547404-54547426 ACTTTTCCATTGGAGAGCTGAGG - Intergenic
1041529274 8:58844698-58844720 ACTAAAACATGGCTGAGCTGAGG + Intronic
1044111144 8:88276211-88276233 ACTTTTGTGTGTCTGAGCTTGGG - Intronic
1050447030 9:5735298-5735320 ACTTTTCCATGCCTGATGTGTGG - Intronic
1051246479 9:15117036-15117058 CCCTTTGCATGGCTTAACTGAGG - Intergenic
1057940081 9:99274251-99274273 TCTGTTGCCTGCCTGAGCTGTGG + Intergenic
1058185535 9:101850005-101850027 ACTTTGGCAGGGCTTAGGTGAGG - Intergenic
1059989488 9:119851635-119851657 CCTTTAGCGTGGCTGAGATGGGG - Intergenic
1061071013 9:128310784-128310806 ACTGTTGTCTGGCTCAGCTGAGG - Intronic
1061193271 9:129094419-129094441 ACTTTTGCTGGGCTCAGTTGGGG + Intergenic
1185853635 X:3512056-3512078 ACTTTTCCATGGCTGGGGTTGGG + Intergenic
1186178691 X:6951621-6951643 ATTTATGCCTGGCTGAGCTGGGG - Intergenic
1189370997 X:40429184-40429206 TCTCTTGCATGGCTTACCTGGGG + Intergenic
1190956860 X:55203879-55203901 ACTTTATCATGGCTGTTCTGAGG - Intronic
1192145569 X:68680057-68680079 ACTTTGGCATGGGTTACCTGGGG + Intronic
1192703152 X:73497770-73497792 ACATTGGCTTTGCTGAGCTGTGG + Intergenic
1194624796 X:96214937-96214959 ACATTGGCTTTGCTGAGCTGCGG - Intergenic
1195489874 X:105454877-105454899 ACTGTAGCATGGCTTTGCTGGGG - Intronic
1196031528 X:111098725-111098747 GCTTTTACATGGGTGGGCTGGGG + Intronic
1196396589 X:115269491-115269513 GCTTTTGCATTGCAGAGCAGTGG + Intergenic
1197989366 X:132300636-132300658 ACTTTTTCATGGCAGAGATAGGG - Intergenic
1198805161 X:140486938-140486960 TCTTATGCATGGCTGAGTTGAGG + Intergenic
1199690622 X:150306527-150306549 ACTTGTGCACAGCTGAGGTGAGG - Intergenic
1200809810 Y:7472459-7472481 ACTTTTCCATGGCTGGGGTTGGG - Intergenic